CU102695 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATCATCTGGGGTCCAGAGCACGGTGCATTCGTGGCACTTGGTTCGGGTCCGGGTCAAATAGAAGTCTGCCATTGGATATTCGAGAACGACATGTCGTGGAATGTTGCTGATTGAATGAATTTTTATTTTTATTTTTATTTTGCTAATATTATTGTTACCAAAACCATGGTTTATTTTAATTTAATTCAATGTTTTTAATTTCGGTAGGTTTAGTG
BLAST of CU102695 vs. Swiss-Prot
Match: GP1_SOLLC (Polygalacturonase-1 non-catalytic subunit beta OS=Solanum lycopersicum GN=GP1 PE=1 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.6e-13 Identity = 30/35 (85.71%), Postives = 31/35 (88.57%), Query Frame = 2
BLAST of CU102695 vs. Swiss-Prot
Match: PGL2_ARATH (Polygalacturonase 1 beta-like protein 2 OS=Arabidopsis thaliana GN=PGL2 PE=2 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.6e-13 Identity = 29/35 (82.86%), Postives = 30/35 (85.71%), Query Frame = 2
BLAST of CU102695 vs. Swiss-Prot
Match: GP3_SOLLC (Polygalacturonase non-catalytic subunit AroGP3 OS=Solanum lycopersicum GN=GP3 PE=3 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 3.5e-13 Identity = 30/35 (85.71%), Postives = 31/35 (88.57%), Query Frame = 2
BLAST of CU102695 vs. Swiss-Prot
Match: GP2_SOLLC (Polygalacturonase non-catalytic subunit AroGP2 OS=Solanum lycopersicum GN=GP2 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.5e-13 Identity = 29/35 (82.86%), Postives = 31/35 (88.57%), Query Frame = 2
BLAST of CU102695 vs. Swiss-Prot
Match: PGL3_ARATH (Polygalacturonase 1 beta-like protein 3 OS=Arabidopsis thaliana GN=PGL3 PE=2 SV=2) HSP 1 Score: 72.0 bits (175), Expect = 2.9e-12 Identity = 28/35 (80.00%), Postives = 30/35 (85.71%), Query Frame = 2
BLAST of CU102695 vs. TrEMBL
Match: A0A0A0LP63_CUCSA (Polygalacturonase-1 non-catalytic subunit beta OS=Cucumis sativus GN=Csa_1G005490 PE=4 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 6.3e-14 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU102695 vs. TrEMBL
Match: B9I388_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s08060g PE=4 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 1.3e-11 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 2
BLAST of CU102695 vs. TrEMBL
Match: A0A0V0IF33_SOLCH (Putative polygalacturonase non-catalytic subunit AroGP2-like (Fragment) OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.3e-11 Identity = 29/35 (82.86%), Postives = 33/35 (94.29%), Query Frame = 2
BLAST of CU102695 vs. TrEMBL
Match: V9TH77_TOBAC (Polygalacturonase isoenzyme 1 beta subunit OS=Nicotiana tabacum GN=GP1 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.7e-11 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 2
BLAST of CU102695 vs. TrEMBL
Match: M1D223_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400030982 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.3e-11 Identity = 29/36 (80.56%), Postives = 34/36 (94.44%), Query Frame = 2
BLAST of CU102695 vs. NCBI nr
Match: gi|449441023|ref|XP_004138283.1| (PREDICTED: probable polygalacturonase non-catalytic subunit JP650 [Cucumis sativus]) HSP 1 Score: 86.7 bits (213), Expect = 1.8e-14 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU102695 vs. NCBI nr
Match: gi|659105447|ref|XP_008453099.1| (PREDICTED: probable polygalacturonase non-catalytic subunit JP650 [Cucumis melo]) HSP 1 Score: 82.4 bits (202), Expect = 3.5e-13 Identity = 33/35 (94.29%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU102695 vs. NCBI nr
Match: gi|566197370|ref|XP_002318036.2| (hypothetical protein POPTR_0012s08060g [Populus trichocarpa]) HSP 1 Score: 79.0 bits (193), Expect = 3.8e-12 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 2
BLAST of CU102695 vs. NCBI nr
Match: gi|970029940|ref|XP_015076285.1| (PREDICTED: polygalacturonase-1 non-catalytic subunit beta [Solanum pennellii]) HSP 1 Score: 78.6 bits (192), Expect = 5.0e-12 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 2
BLAST of CU102695 vs. NCBI nr
Match: gi|350538029|ref|NP_001234835.1| (polygalacturonase-1 non-catalytic subunit beta precursor [Solanum lycopersicum]) HSP 1 Score: 78.6 bits (192), Expect = 5.0e-12 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|