CU115121 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCCGTCTTCTTGCATTCCTGATGCTTTGTATCTGAACTATTGCATTCCTGAGCATCTCTAAGAACCTTCGCAAGCTCCATTCCTTTTTTTGCCTTCCATTTTATCACAAATATTTCGCAGCCGCTCAATGTCAAGAGAAGAACAGAGATTTTCCACATCTTCCGCAGAAAGATCAAGCAAAGACTGAGATATCGCAGGCCCAGAAAGCGTTCTAAGGCGAGTCCGTTCTTTTCGTAGGAGTTTCTTCTCCTTCTCTTTCAACTTTTTCTGCTGTTGAGCCAGTTCTGCAGCACGTTTCTCCTC
BLAST of CU115121 vs. TrEMBL
Match: A0A0A0LAD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G223330 PE=4 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 5.8e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU115121 vs. TrEMBL
Match: A0A0A0LAD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G223330 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.3e-08 Identity = 30/33 (90.91%), Postives = 31/33 (93.94%), Query Frame = -2
HSP 2 Score: 62.4 bits (150), Expect = 3.7e-07 Identity = 29/40 (72.50%), Postives = 33/40 (82.50%), Query Frame = -1
BLAST of CU115121 vs. TrEMBL
Match: M5VIQ8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa002636mg PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.8e-06 Identity = 27/40 (67.50%), Postives = 34/40 (85.00%), Query Frame = -1
BLAST of CU115121 vs. TrEMBL
Match: A0A061FQZ2_THECC (DnaJ domain,Myb-like DNA-binding domain OS=Theobroma cacao GN=TCM_044616 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = -1
BLAST of CU115121 vs. TrEMBL
Match: A0A0L9VGQ7_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan09g275100 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 3.1e-06 Identity = 26/40 (65.00%), Postives = 34/40 (85.00%), Query Frame = -1
BLAST of CU115121 vs. NCBI nr
Match: gi|449457039|ref|XP_004146256.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Cucumis sativus]) HSP 1 Score: 81.6 bits (200), Expect = 8.4e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU115121 vs. NCBI nr
Match: gi|659112064|ref|XP_008456047.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 2.4e-12 Identity = 39/40 (97.50%), Postives = 39/40 (97.50%), Query Frame = -1
BLAST of CU115121 vs. NCBI nr
Match: gi|802540159|ref|XP_012075001.1| (PREDICTED: dnaJ homolog subfamily C member 2 [Jatropha curcas]) HSP 1 Score: 62.4 bits (150), Expect = 5.3e-07 Identity = 29/40 (72.50%), Postives = 33/40 (82.50%), Query Frame = -1
BLAST of CU115121 vs. NCBI nr
Match: gi|595791969|ref|XP_007199733.1| (hypothetical protein PRUPE_ppa002636mg [Prunus persica]) HSP 1 Score: 60.1 bits (144), Expect = 2.6e-06 Identity = 27/40 (67.50%), Postives = 34/40 (85.00%), Query Frame = -1
BLAST of CU115121 vs. NCBI nr
Match: gi|645260575|ref|XP_008235893.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Prunus mume]) HSP 1 Score: 60.1 bits (144), Expect = 2.6e-06 Identity = 27/40 (67.50%), Postives = 34/40 (85.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|