CU115931 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCTACTGCACAGCATGAAATTTGGTACTTTTGATGGCTATGAACTTTGCGTTTACTTACGGAAAATACAAGGGGAGCTCCATCACCATTTTGGGTCGGAACCCTATTCTGAACCAAGTACGAGAGATGCCAGTGGTGGGAGGAACTGGACGGTTCCGATTTGCTAAAGGTCATGCGCTGGCTAAGACTCAATATTTCAACGCTACTACATTGGATGCTGTTGTTGAATATGATATTTATGTATTGCATTATTATTGATAGTCCATTTTTAAATTAAACTTCTCTCCACGTGTTTTTCTTTATTTCTATGTTTTGTATTATTTCCTCTTATCTTTCCCAAATCTCAATAATGTTAGTTTTCATGTGATTGTTTTTTTATAATATATGATTCTTTTTTTCTAGTT
BLAST of CU115931 vs. Swiss-Prot
Match: DIR20_ARATH (Dirigent protein 20 OS=Arabidopsis thaliana GN=DIR20 PE=2 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 4.9e-21 Identity = 49/77 (63.64%), Postives = 57/77 (74.03%), Query Frame = 3
BLAST of CU115931 vs. Swiss-Prot
Match: DIR21_ARATH (Dirigent protein 21 OS=Arabidopsis thaliana GN=DIR21 PE=3 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 1.1e-20 Identity = 45/76 (59.21%), Postives = 58/76 (76.32%), Query Frame = 3
BLAST of CU115931 vs. Swiss-Prot
Match: DIR7_ARATH (Dirigent protein 7 OS=Arabidopsis thaliana GN=DIR7 PE=2 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.4e-20 Identity = 47/74 (63.51%), Postives = 55/74 (74.32%), Query Frame = 3
BLAST of CU115931 vs. Swiss-Prot
Match: DIR19_ARATH (Dirigent protein 19 OS=Arabidopsis thaliana GN=DIR19 PE=2 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-20 Identity = 46/75 (61.33%), Postives = 57/75 (76.00%), Query Frame = 3
BLAST of CU115931 vs. Swiss-Prot
Match: DIR3_ARATH (Dirigent protein 3 OS=Arabidopsis thaliana GN=DIR3 PE=3 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 2.5e-20 Identity = 47/75 (62.67%), Postives = 58/75 (77.33%), Query Frame = 3
BLAST of CU115931 vs. TrEMBL
Match: A0A0A0KX42_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G280650 PE=4 SV=1) HSP 1 Score: 157.1 bits (396), Expect = 1.4e-35 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 3
BLAST of CU115931 vs. TrEMBL
Match: A0A0A0LUT3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G015830 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 8.2e-23 Identity = 53/75 (70.67%), Postives = 64/75 (85.33%), Query Frame = 3
BLAST of CU115931 vs. TrEMBL
Match: U5CLY9_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s03766p00005550 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 1.1e-22 Identity = 53/78 (67.95%), Postives = 65/78 (83.33%), Query Frame = 3
BLAST of CU115931 vs. TrEMBL
Match: A0A151T970_CAJCA (Disease resistance response protein 206 family OS=Cajanus cajan GN=KK1_018189 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 1.1e-22 Identity = 52/77 (67.53%), Postives = 65/77 (84.42%), Query Frame = 3
BLAST of CU115931 vs. TrEMBL
Match: V7B2Z5_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G091600g PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 3.1e-22 Identity = 51/77 (66.23%), Postives = 64/77 (83.12%), Query Frame = 3
BLAST of CU115931 vs. NCBI nr
Match: gi|778693014|ref|XP_011653564.1| (PREDICTED: dirigent protein 22-like [Cucumis sativus]) HSP 1 Score: 157.9 bits (398), Expect = 1.2e-35 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 3
BLAST of CU115931 vs. NCBI nr
Match: gi|659097739|ref|XP_008449786.1| (PREDICTED: dirigent protein 22-like [Cucumis melo]) HSP 1 Score: 153.3 bits (386), Expect = 3.0e-34 Identity = 72/76 (94.74%), Postives = 75/76 (98.68%), Query Frame = 3
BLAST of CU115931 vs. NCBI nr
Match: gi|659106501|ref|XP_008453355.1| (PREDICTED: dirigent protein 22-like [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 5.7e-25 Identity = 56/75 (74.67%), Postives = 65/75 (86.67%), Query Frame = 3
BLAST of CU115931 vs. NCBI nr
Match: gi|1009124088|ref|XP_015878883.1| (PREDICTED: dirigent protein 22-like [Ziziphus jujuba]) HSP 1 Score: 116.7 bits (291), Expect = 3.1e-23 Identity = 54/75 (72.00%), Postives = 63/75 (84.00%), Query Frame = 3
BLAST of CU115931 vs. NCBI nr
Match: gi|449441137|ref|XP_004138340.1| (PREDICTED: dirigent protein 22 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 5.3e-23 Identity = 53/75 (70.67%), Postives = 64/75 (85.33%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|