CU117688 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTAAACAAGTACTTAAGATGGGGAAAGTTTAACTTTTGTTTGATTGGAACTTACAACACTAAACCACCATTTCTCACTCACTGTACAGATAAAGACAGCAGAAATAGTGATGATTTGACCCGTTAGATTAGAGTTTGAGAGTAAGATCAAGGGTCGAGTTTTCGACATCCTCCCACGTCTTATCTGCTGAGCTTATGCTTGAAATACCAGTCAATATGAAACTTGGTCGAGTTAGTTCATCAGTGTTTCTAGTTTCTACCATTGGACGAAAACTACC
BLAST of CU117688 vs. TrEMBL
Match: A0A0A0LBR9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G196420 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.5e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -1
BLAST of CU117688 vs. NCBI nr
Match: gi|449446113|ref|XP_004140816.1| (PREDICTED: zinc finger protein 4-like [Cucumis sativus]) HSP 1 Score: 100.1 bits (248), Expect = 2.1e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -1
BLAST of CU117688 vs. NCBI nr
Match: gi|659112391|ref|XP_008456195.1| (PREDICTED: zinc finger protein 4-like [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 2.1e-15 Identity = 46/49 (93.88%), Postives = 47/49 (95.92%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|