CU119698 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGTCCATGGGGTTGGGAACTGGATCCTCCGAAATGGAATAATTCACACTCACACTCAGCAGTGAAAGGATAAGATAGAATTTCCCCTTCGAAGTCGTCATGGCTTCGTAGTTCTCTCTCCTCTGTCCATCTAATTAAATTAAATTTTAAATTTGTTACTTAATTTCTAGCTATGTACAAATATCCTTCTTCTTTT
BLAST of CU119698 vs. TrEMBL
Match: A0A0A0KAA8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G091320 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 3.0e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = -3
BLAST of CU119698 vs. NCBI nr
Match: gi|778711724|ref|XP_004140560.2| (PREDICTED: uncharacterized protein At4g14100-like [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 3.3e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = -3
BLAST of CU119698 vs. NCBI nr
Match: gi|700191204|gb|KGN46408.1| (hypothetical protein Csa_6G091320 [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 3.3e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|