CU122273 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGAAAGGAATATTCGTTCCATGGATGGATTTTTTTTATGAAGCAATAATAGATAGTATAGTAGTAACAAAACTTGGAGGTCCACCAGTCTACCGCGCCACGCCCTGGACCTTACCGGCGAAAGAGACATATACCAGACCAAGATGAAGAAGAAGAAGAAAAATAAGACAATTTTACCCCCTTTAATTTCCTTCCCTCAAATCTTCTGCAGTTTCTCCCCTTTCACCACCGGATTCGCCTTCGCGATCTGCTCCTTTCCCATCTGCTTGAAGTCAAATTCACACCCGTGTTGTTCCGGGTACCGGTGACTCCCACAATACACCATCCCACACCGGCACTTGAACCCCGTCAACCCCACGCGCCGCCTGCACGTCATACATCGGCTCGGCTGCTGTTGTTGTCTTTCCTCCGCCGCTGCCGTCCGAACCACTTCCGTCCTCACCTCCTCTTCCTCCTCCACGCGTTGTTCCTTCGCTTCCGGTTCCGGATTTAACAACAACGACGCCGCCCGGGTTTGGTTTAAGGCGAGTTTAGCGGTGGAGGATTGGTGGTCCTTCCACTGCCGATCGTCGGTAACCTTTTGGACAGAATTAATACAGAGGCGGGGCAGCCTAAGTACTCGCATTTGGTTGCTCGATGGTAGGGGGGCTGGCATTCTAGTATGTAGACTAGCCTAGCGTCAGACCGAGTTCCCTCTCACGCCCTAGTCCTGGAGCTAGTTGATAGGCATCGAGCAGCGGTGGTGATGCTGGGAGGTGATTTTTGCATCTCATCGTCACCAACAGACAGAACAAGAAGTAGAATC
BLAST of CU122273 vs. Swiss-Prot
Match: SAP3_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 3 OS=Arabidopsis thaliana GN=SAP3 PE=2 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 3.1e-22 Identity = 61/149 (40.94%), Postives = 74/149 (49.66%), Query Frame = -1
BLAST of CU122273 vs. Swiss-Prot
Match: SAP6_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 6 OS=Arabidopsis thaliana GN=SAP6 PE=2 SV=2) HSP 1 Score: 100.5 bits (249), Expect = 2.9e-20 Identity = 40/55 (72.73%), Postives = 46/55 (83.64%), Query Frame = -1
BLAST of CU122273 vs. Swiss-Prot
Match: SAP4_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 4 OS=Arabidopsis thaliana GN=SAP4 PE=1 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 6.5e-20 Identity = 40/55 (72.73%), Postives = 44/55 (80.00%), Query Frame = -1
BLAST of CU122273 vs. Swiss-Prot
Match: SAP14_ORYSJ (Zinc finger AN1 domain-containing stress-associated protein 14 OS=Oryza sativa subsp. japonica GN=SAP14 PE=2 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 1.0e-17 Identity = 37/54 (68.52%), Postives = 42/54 (77.78%), Query Frame = -1
BLAST of CU122273 vs. Swiss-Prot
Match: SAP1_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 1 OS=Arabidopsis thaliana GN=SAP1 PE=1 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 1.3e-17 Identity = 35/54 (64.81%), Postives = 44/54 (81.48%), Query Frame = -1
BLAST of CU122273 vs. TrEMBL
Match: B9SCR6_RICCO (Zinc finger protein, putative OS=Ricinus communis GN=RCOM_1280190 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 7.4e-23 Identity = 66/154 (42.86%), Postives = 79/154 (51.30%), Query Frame = -1
BLAST of CU122273 vs. TrEMBL
Match: B9H1R6_POPTR (Zinc finger family protein OS=Populus trichocarpa GN=POPTR_0004s19500g PE=4 SV=2) HSP 1 Score: 115.5 bits (288), Expect = 9.7e-23 Identity = 48/55 (87.27%), Postives = 53/55 (96.36%), Query Frame = -1
BLAST of CU122273 vs. TrEMBL
Match: A0A0D2VIP9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G258400 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 1.7e-22 Identity = 62/140 (44.29%), Postives = 75/140 (53.57%), Query Frame = -1
BLAST of CU122273 vs. TrEMBL
Match: B9HQW9_POPTR (Zinc finger family protein OS=Populus trichocarpa GN=POPTR_0009s14630g PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 3.7e-22 Identity = 47/55 (85.45%), Postives = 52/55 (94.55%), Query Frame = -1
BLAST of CU122273 vs. TrEMBL
Match: W9QJ81_9ROSA (Zinc finger A20 and AN1 domain-containing stress-associated protein 3 OS=Morus notabilis GN=L484_022365 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 8.2e-22 Identity = 48/55 (87.27%), Postives = 51/55 (92.73%), Query Frame = -1
BLAST of CU122273 vs. NCBI nr
Match: gi|449463078|ref|XP_004149261.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Cucumis sativus]) HSP 1 Score: 152.5 bits (384), Expect = 1.0e-33 Identity = 82/140 (58.57%), Postives = 85/140 (60.71%), Query Frame = -1
BLAST of CU122273 vs. NCBI nr
Match: gi|659117390|ref|XP_008458577.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Cucumis melo]) HSP 1 Score: 138.3 bits (347), Expect = 2.0e-29 Identity = 80/148 (54.05%), Postives = 85/148 (57.43%), Query Frame = -1
BLAST of CU122273 vs. NCBI nr
Match: gi|568869513|ref|XP_006487967.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Citrus sinensis]) HSP 1 Score: 118.2 bits (295), Expect = 2.1e-23 Identity = 66/140 (47.14%), Postives = 77/140 (55.00%), Query Frame = -1
BLAST of CU122273 vs. NCBI nr
Match: gi|729348434|ref|XP_010542567.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3-like [Tarenaya hassleriana]) HSP 1 Score: 117.5 bits (293), Expect = 3.7e-23 Identity = 67/144 (46.53%), Postives = 75/144 (52.08%), Query Frame = -1
BLAST of CU122273 vs. NCBI nr
Match: gi|702474101|ref|XP_010031502.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3-like [Eucalyptus grandis]) HSP 1 Score: 116.7 bits (291), Expect = 6.2e-23 Identity = 60/123 (48.78%), Postives = 68/123 (55.28%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|