CU122648 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGAGCTCCAGTTCTAATTTGAGGGATTGTCGATAACAGAACACCATTCTGGCCTCGTCTTCAAAAGCCCTACTAATACAATCCCTTTCCTCCATCAATTTTTGCCGCCTTCCTCTCCGCCTCTTCTTGCCCTCGTTTGCGACAGTCTCAGAGCCCTTCAACACGCTCCATTTTT
BLAST of CU122648 vs. TrEMBL
Match: A0A0A0KZ57_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G097690 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-07 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = -3
BLAST of CU122648 vs. NCBI nr
Match: gi|778691835|ref|XP_011653361.1| (PREDICTED: uncharacterized protein LOC105435202 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 3.9e-07 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = -3
BLAST of CU122648 vs. NCBI nr
Match: gi|700198504|gb|KGN53662.1| (hypothetical protein Csa_4G097690 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 3.9e-07 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = -3
BLAST of CU122648 vs. NCBI nr
Match: gi|659111298|ref|XP_008455680.1| (PREDICTED: uncharacterized protein LOC103495794 [Cucumis melo]) HSP 1 Score: 59.7 bits (143), Expect = 1.9e-06 Identity = 30/33 (90.91%), Postives = 32/33 (96.97%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|