CU122374 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATACGGCACGAGGCTAAATTAAATACTAAGGATTTAATTTTCATTTCTCTTCTCTCGAAAGAACGATCCAGAAGAGCCCAGGCTCGACGGGACATTGTCTGGACCTTTCTTCCACTCTTCAAGGAATCTCGAAAACAACTCACAACCGCCCTTCTCCCTCTTGTCGCTGCTTCTCGTTTTCTTCCTTTATAATTCTCTACCCTATTCCTTCTTTCTTTCTTCCTTCCTACCTATATCTCTTCTTCATTTTCTATATTCCCTTTCCTCCCTCCCTTAATTCATCGCGACACGGATTTTGTTATTTTAGGTATTGTTGTTTTTTTTAACGGACCGAGGCTGAAGAACACAGATGCTTCGCGCCCAAACTTTGTGCGAACAAATGCGGGTTCTTTGGCAGTCCCGCCACGAGAGATTTCTGTTCTAAATGTTACCGAAATCTGCAGTTGAAGGAACAACATTCCTCCACCGCTAAACTCGCCTTAAACCAAACCCTGGCGGCGTCGTTGTTGTTAAATCCGGAACCGGAAGCGAATGAGAACGCGTGGAGGACGAAGAGGAGGTGAGGACTGAACAAGTTTGTGACGGGTCGAGCTGAGTAAAGACAACAAATCAAGACGAGCGAGGTATCACGTGTATGCAGCTCGAGGGGTAGACCGGCTAAAGTGACGATGTAGGATGGTATATATGAAAGACATGATCTAGTGGATGCTACTGTAACGTCATCTGACGTCGCAGCAGACTGCGTTCTGAAGGCTCCACCACAGCCGTACGGGCTACATTTGTGAACTAACTTGCGAGCACTGTTG
BLAST of CU122374 vs. Swiss-Prot
Match: SAP3_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 3 OS=Arabidopsis thaliana GN=SAP3 PE=2 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 1.4e-14 Identity = 38/55 (69.09%), Postives = 44/55 (80.00%), Query Frame = 1
BLAST of CU122374 vs. Swiss-Prot
Match: SAP4_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 4 OS=Arabidopsis thaliana GN=SAP4 PE=1 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 1.5e-08 Identity = 28/57 (49.12%), Postives = 35/57 (61.40%), Query Frame = 1
BLAST of CU122374 vs. Swiss-Prot
Match: SAP6_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 6 OS=Arabidopsis thaliana GN=SAP6 PE=2 SV=2) HSP 1 Score: 60.8 bits (146), Expect = 2.6e-08 Identity = 30/64 (46.88%), Postives = 40/64 (62.50%), Query Frame = 1
BLAST of CU122374 vs. Swiss-Prot
Match: SAP7_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 7 OS=Arabidopsis thaliana GN=SAP7 PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 7.4e-08 Identity = 24/45 (53.33%), Postives = 31/45 (68.89%), Query Frame = 1
BLAST of CU122374 vs. Swiss-Prot
Match: SAP9_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 9 OS=Arabidopsis thaliana GN=SAP9 PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 4.8e-07 Identity = 24/58 (41.38%), Postives = 32/58 (55.17%), Query Frame = 1
BLAST of CU122374 vs. TrEMBL
Match: A0A0A0KB65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G152950 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 3.5e-28 Identity = 69/95 (72.63%), Postives = 72/95 (75.79%), Query Frame = 1
BLAST of CU122374 vs. TrEMBL
Match: A0A059DA79_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_B03873 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 2.2e-19 Identity = 47/69 (68.12%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CU122374 vs. TrEMBL
Match: V4RSE2_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10029439mg PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 4.0e-16 Identity = 42/66 (63.64%), Postives = 51/66 (77.27%), Query Frame = 1
BLAST of CU122374 vs. TrEMBL
Match: A0A067KRF9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_07939 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 5.2e-16 Identity = 43/69 (62.32%), Postives = 51/69 (73.91%), Query Frame = 1
BLAST of CU122374 vs. TrEMBL
Match: V7BZK7_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_005G125000g PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 6.8e-16 Identity = 44/71 (61.97%), Postives = 54/71 (76.06%), Query Frame = 1
BLAST of CU122374 vs. NCBI nr
Match: gi|449463078|ref|XP_004149261.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 6.5e-28 Identity = 69/95 (72.63%), Postives = 72/95 (75.79%), Query Frame = 1
BLAST of CU122374 vs. NCBI nr
Match: gi|659117390|ref|XP_008458577.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Cucumis melo]) HSP 1 Score: 119.4 bits (298), Expect = 9.7e-24 Identity = 69/113 (61.06%), Postives = 76/113 (67.26%), Query Frame = 1
BLAST of CU122374 vs. NCBI nr
Match: gi|702280181|ref|XP_010045231.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3-like [Eucalyptus grandis]) HSP 1 Score: 104.0 bits (258), Expect = 4.2e-19 Identity = 47/69 (68.12%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CU122374 vs. NCBI nr
Match: gi|502145758|ref|XP_004506164.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3-like [Cicer arietinum]) HSP 1 Score: 94.0 bits (232), Expect = 4.4e-16 Identity = 42/61 (68.85%), Postives = 50/61 (81.97%), Query Frame = 1
BLAST of CU122374 vs. NCBI nr
Match: gi|1012029512|ref|XP_015951691.1| (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 3 [Arachis duranensis]) HSP 1 Score: 93.6 bits (231), Expect = 5.7e-16 Identity = 42/53 (79.25%), Postives = 44/53 (83.02%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|