CU123799 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGCTTCCCAATTGCCTCAAGGGCTGGTGCTCCAATGTTTTTACAAAAGCTTAAATCCAAAAAAGTTACAGCAGAAAGCTTGTCAGCAACCTGTTCTACAGTTGAATTGGTTATTTCGCTTCTTGGTACCCGTAAAGTACGAAGGGCTTTGCCATGTTTTGCAATCAGGGACAAACTAGAGTCATTAGGGAGA
BLAST of CU123799 vs. Swiss-Prot
Match: FBW2_ARATH (F-box protein FBW2 OS=Arabidopsis thaliana GN=FBW2 PE=1 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-13 Identity = 38/63 (60.32%), Postives = 47/63 (74.60%), Query Frame = -2
BLAST of CU123799 vs. TrEMBL
Match: A0A0A0L0J6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G096100 PE=4 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 4.2e-25 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = -2
BLAST of CU123799 vs. TrEMBL
Match: A0A061DJC8_THECC (F-box with wd-40 2 isoform 1 OS=Theobroma cacao GN=TCM_001074 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.2e-16 Identity = 45/63 (71.43%), Postives = 56/63 (88.89%), Query Frame = -2
BLAST of CU123799 vs. TrEMBL
Match: A0A0B0MJ50_GOSAR (F-box FBW2-like protein OS=Gossypium arboreum GN=F383_19029 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.6e-16 Identity = 45/63 (71.43%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU123799 vs. TrEMBL
Match: A0A0D2MJ12_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G040600 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 2.7e-16 Identity = 45/63 (71.43%), Postives = 54/63 (85.71%), Query Frame = -2
BLAST of CU123799 vs. TrEMBL
Match: A0A0B0NB98_GOSAR (F-box FBW2-like protein OS=Gossypium arboreum GN=F383_15094 PE=4 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 1.8e-15 Identity = 44/63 (69.84%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU123799 vs. NCBI nr
Match: gi|449438827|ref|XP_004137189.1| (PREDICTED: F-box protein FBW2-like [Cucumis sativus]) HSP 1 Score: 121.3 bits (303), Expect = 6.1e-25 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = -2
BLAST of CU123799 vs. NCBI nr
Match: gi|659111194|ref|XP_008455627.1| (PREDICTED: F-box protein FBW2-like [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 1.9e-23 Identity = 59/63 (93.65%), Postives = 61/63 (96.83%), Query Frame = -2
BLAST of CU123799 vs. NCBI nr
Match: gi|590707063|ref|XP_007047899.1| (F-box with wd-40 2 isoform 1 [Theobroma cacao]) HSP 1 Score: 93.2 bits (230), Expect = 1.8e-16 Identity = 45/63 (71.43%), Postives = 56/63 (88.89%), Query Frame = -2
BLAST of CU123799 vs. NCBI nr
Match: gi|728811706|gb|KHG00392.1| (F-box FBW2 -like protein [Gossypium arboreum]) HSP 1 Score: 92.8 bits (229), Expect = 2.3e-16 Identity = 45/63 (71.43%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU123799 vs. NCBI nr
Match: gi|823139890|ref|XP_012469807.1| (PREDICTED: F-box protein FBW2-like [Gossypium raimondii]) HSP 1 Score: 92.0 bits (227), Expect = 3.9e-16 Identity = 45/63 (71.43%), Postives = 54/63 (85.71%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|