CU123542 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTTGATCAAGAGTGGGGAAGATGGGTTGAGGTAAAAATTTGGGGAATGAATCCTTTGTTTTGGGAAATGATTGTTGTTTTTTCAGTTTCAACTCCATATTTTAAAGGACTTAAAGGGAGTTGCATATACTTTACTCATACACCAAAATGTGCTCTTGGTTATAACACTCTTGTATTTGAGCTTGAAGAGAAAAAGGATTCTGAACGCCTTTTCAAATGATAATGCACC
BLAST of CU123542 vs. TrEMBL
Match: A0A0A0KJJ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G507420 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 7.5e-21 Identity = 51/65 (78.46%), Postives = 52/65 (80.00%), Query Frame = 2
BLAST of CU123542 vs. NCBI nr
Match: gi|778719846|ref|XP_004134837.2| (PREDICTED: putative F-box protein At1g65770 [Cucumis sativus]) HSP 1 Score: 109.0 bits (271), Expect = 3.7e-21 Identity = 51/65 (78.46%), Postives = 52/65 (80.00%), Query Frame = 2
BLAST of CU123542 vs. NCBI nr
Match: gi|659081066|ref|XP_008441132.1| (PREDICTED: F-box protein At2g17036 [Cucumis melo]) HSP 1 Score: 100.5 bits (249), Expect = 1.3e-18 Identity = 47/65 (72.31%), Postives = 50/65 (76.92%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|