CU124001 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGCGGAAGAGGGGTTGGAGGCGGCAATGGAGGAAGCAATCTGAGAGAGAGAGATGGGAGAGCCATGGGAGTTGATGATATCGGCTAAGTGAAGTTCGACGGCACATTTTAAAGCCATGGAATCGGCAAAACAGAGCATGTACTTCCATATCTCTGCCTGCCCTTGTAGCAGTGCCTCTGCTTCTTTAGCTTCTTTGGCTTCCATTTCTAATTTCTTTTGGGTTGAAGTTGTTTTGTTTTGCCCCCGG
BLAST of CU124001 vs. Swiss-Prot
Match: 7OMT_PAPSO ((R,S)-reticuline 7-O-methyltransferase OS=Papaver somniferum GN=7OMT PE=1 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 8.1e-06 Identity = 22/30 (73.33%), Postives = 23/30 (76.67%), Query Frame = -2
BLAST of CU124001 vs. TrEMBL
Match: A0A0A0KAJ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G128650 PE=3 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 9.3e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -2
BLAST of CU124001 vs. NCBI nr
Match: gi|659094854|ref|XP_008448276.1| (PREDICTED: (R,S)-reticuline 7-O-methyltransferase-like [Cucumis melo]) HSP 1 Score: 67.4 bits (163), Expect = 1.3e-08 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -2
BLAST of CU124001 vs. NCBI nr
Match: gi|449444344|ref|XP_004139935.1| (PREDICTED: (R,S)-reticuline 7-O-methyltransferase-like [Cucumis sativus]) HSP 1 Score: 67.4 bits (163), Expect = 1.3e-08 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|