CU132079 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCAGCTGTTCTGCTTGTGGTAGATTTTGGCGGTTGGTTTAGGCTCGACACAAAGTCCTCTAATGGTTCCTCGCCAGATATGATTCAGCACACTCAAGTTTCAGTACTTAAGGATGTGATTGTGCCATACACCCATTTACTACCTAGGCTGCACTTATCAGCAAACAAGAAGCGTCAGACCTTACTTTATTTCAAAAGGGGCGAAACATAGGCATCGGGGAGGATTGGTCAGGGGAGAAACTCTG
BLAST of CU132079 vs. TrEMBL
Match: A0A0A0K3Q7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G201900 PE=4 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 6.1e-29 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 1
BLAST of CU132079 vs. TrEMBL
Match: A0A067KDW4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12702 PE=4 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 4.1e-25 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 1
BLAST of CU132079 vs. TrEMBL
Match: A0A067KDW4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12702 PE=4 SV=1) HSP 1 Score: 31.2 bits (69), Expect = 7.3e+02 Identity = 16/30 (53.33%), Postives = 19/30 (63.33%), Query Frame = 2
HSP 2 Score: 120.2 bits (300), Expect = 1.2e-24 Identity = 57/65 (87.69%), Postives = 61/65 (93.85%), Query Frame = 1
BLAST of CU132079 vs. TrEMBL
Match: B9IQM2_POPTR (Exostosin family protein OS=Populus trichocarpa GN=POPTR_0019s11670g PE=4 SV=1) HSP 1 Score: 32.7 bits (73), Expect = 2.5e+02 Identity = 16/22 (72.73%), Postives = 17/22 (77.27%), Query Frame = 2
HSP 2 Score: 119.4 bits (298), Expect = 2.0e-24 Identity = 57/65 (87.69%), Postives = 60/65 (92.31%), Query Frame = 1
BLAST of CU132079 vs. TrEMBL
Match: A0A061FJD6_THECC (Exostosin family protein OS=Theobroma cacao GN=TCM_036641 PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 4.3e+02 Identity = 13/13 (100.00%), Postives = 13/13 (100.00%), Query Frame = 2
HSP 2 Score: 118.6 bits (296), Expect = 3.5e-24 Identity = 54/65 (83.08%), Postives = 61/65 (93.85%), Query Frame = 1
BLAST of CU132079 vs. NCBI nr
Match: gi|778725585|ref|XP_004139861.2| (PREDICTED: probable arabinosyltransferase ARAD2 [Cucumis sativus]) HSP 1 Score: 136.7 bits (343), Expect = 1.8e-29 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 1
BLAST of CU132079 vs. NCBI nr
Match: gi|659093871|ref|XP_008447763.1| (PREDICTED: probable arabinosyltransferase ARAD2 [Cucumis melo]) HSP 1 Score: 136.7 bits (343), Expect = 1.8e-29 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 1
BLAST of CU132079 vs. NCBI nr
Match: gi|743917050|ref|XP_011002506.1| (PREDICTED: probable arabinosyltransferase ARAD1 [Populus euphratica]) HSP 1 Score: 125.6 bits (314), Expect = 4.1e-26 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 1
BLAST of CU132079 vs. NCBI nr
Match: gi|1009137914|ref|XP_015886310.1| (PREDICTED: probable arabinosyltransferase ARAD1 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 124.0 bits (310), Expect = 1.2e-25 Identity = 56/65 (86.15%), Postives = 62/65 (95.38%), Query Frame = 1
BLAST of CU132079 vs. NCBI nr
Match: gi|802621769|ref|XP_012076129.1| (PREDICTED: probable arabinosyltransferase ARAD1 [Jatropha curcas]) HSP 1 Score: 124.0 bits (310), Expect = 1.2e-25 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|