CU132225 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATTTCTGAGGTACTTGTCCGTGTCCCGTTCTAATATATTCGAGGCTCCCTTGGCTTCCTTGTTAAATTCCAATACCTTTGATCCCTTTGAAGCTGCTGCATAGTTGTATTCTGCACCGCTAGGCTCTAACCTATGAAAAGTACTTTCCACTTGACCAGCTCTGGTTTTGGTTTCTGAGATAAATGCTCTGCTTTTGAAAACTTCAAGACCAAGGGGTAAAACATGAGATAGGCGATCAAAATTTAGAGTATCAGTTTAG
BLAST of CU132225 vs. TrEMBL
Match: A0A0A0LPZ2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G401390 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 4.0e-39 Identity = 84/85 (98.82%), Postives = 84/85 (98.82%), Query Frame = -2
BLAST of CU132225 vs. TrEMBL
Match: A0A0D2S6Q5_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G267400 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.0e-22 Identity = 57/79 (72.15%), Postives = 66/79 (83.54%), Query Frame = -2
BLAST of CU132225 vs. TrEMBL
Match: A0A0D2RBB4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G267400 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.0e-22 Identity = 57/79 (72.15%), Postives = 66/79 (83.54%), Query Frame = -2
BLAST of CU132225 vs. TrEMBL
Match: B9SBU4_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1044140 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.5e-22 Identity = 54/79 (68.35%), Postives = 63/79 (79.75%), Query Frame = -2
BLAST of CU132225 vs. TrEMBL
Match: A0A0A0KUQ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G647460 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.0e-21 Identity = 55/79 (69.62%), Postives = 63/79 (79.75%), Query Frame = -2
BLAST of CU132225 vs. NCBI nr
Match: gi|778672879|ref|XP_004138825.2| (PREDICTED: uncharacterized protein LOC101220501 [Cucumis sativus]) HSP 1 Score: 167.9 bits (424), Expect = 7.6e-39 Identity = 84/85 (98.82%), Postives = 84/85 (98.82%), Query Frame = -2
BLAST of CU132225 vs. NCBI nr
Match: gi|659081157|ref|XP_008441182.1| (PREDICTED: uncharacterized protein LOC103485395 [Cucumis melo]) HSP 1 Score: 151.8 bits (382), Expect = 5.6e-34 Identity = 78/85 (91.76%), Postives = 78/85 (91.76%), Query Frame = -2
BLAST of CU132225 vs. NCBI nr
Match: gi|823154244|ref|XP_012476988.1| (PREDICTED: uncharacterized protein LOC105792765 [Gossypium raimondii]) HSP 1 Score: 112.1 bits (279), Expect = 4.9e-22 Identity = 57/79 (72.15%), Postives = 66/79 (83.54%), Query Frame = -2
BLAST of CU132225 vs. NCBI nr
Match: gi|763759610|gb|KJB26941.1| (hypothetical protein B456_004G267400 [Gossypium raimondii]) HSP 1 Score: 112.1 bits (279), Expect = 4.9e-22 Identity = 57/79 (72.15%), Postives = 66/79 (83.54%), Query Frame = -2
BLAST of CU132225 vs. NCBI nr
Match: gi|223537291|gb|EEF38922.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 110.9 bits (276), Expect = 1.1e-21 Identity = 54/79 (68.35%), Postives = 63/79 (79.75%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|