CU132973 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAAAAGTGAAAGCAAAAGTGTAAGTAAAGTAGGAAAAGTGTAATGGAAGGTGGTTCCTCCTTTGTCTCGTTGGGAAAATTTATAGATGATGTTTTGGCCAATTCGGCAGGAGGAGGAAACTAAATGACGTAGTTTCATTCATGAGCCTAAAAGCACGTAGACCATTTCATTTTGTTGCCAAA
BLAST of CU132973 vs. NCBI nr
Match: gi|449456657|ref|XP_004146065.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis sativus]) HSP 1 Score: 58.9 bits (141), Expect = 3.5e-06 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|