CU139755 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCATTGAGGAAAGATCGGAATCTTTGTTGCAAAATTCATACCACATTTCTGATTCCTTGGAAACTACTGGTATTCAAATACAACAAGTGGCTCAAACATCAAGGAAACTAGAAGATCACATGGGCGCTGTGCTACACCACTCAGAAAAAAGTTTATGAACAAATCCAGGAGGATGGAGACTTCCCAATTGGAACTTCAAGAAGGCCAGTTAAAAGCTGAGAAAGAAGTTTGGGAGGAAGGAATGGAGATGC
BLAST of CU139755 vs. TrEMBL
Match: A0A0A0L6W7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G194400 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 3.8e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU139755 vs. TrEMBL
Match: A0A0A0L6W7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G194400 PE=4 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.9e-02 Identity = 24/35 (68.57%), Postives = 28/35 (80.00%), Query Frame = 2
HSP 2 Score: 75.9 bits (185), Expect = 2.6e-11 Identity = 37/48 (77.08%), Postives = 43/48 (89.58%), Query Frame = 3
BLAST of CU139755 vs. TrEMBL
Match: A0A0A0KT36_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001620 PE=4 SV=1) HSP 1 Score: 41.2 bits (95), Expect = 7.2e-01 Identity = 21/30 (70.00%), Postives = 26/30 (86.67%), Query Frame = 2
BLAST of CU139755 vs. NCBI nr
Match: gi|700202340|gb|KGN57473.1| (hypothetical protein Csa_3G194400 [Cucumis sativus]) HSP 1 Score: 97.4 bits (241), Expect = 1.2e-17 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU139755 vs. NCBI nr
Match: gi|778688567|ref|XP_011652779.1| (PREDICTED: protein GAMETE EXPRESSED 1-like [Cucumis sativus]) HSP 1 Score: 97.4 bits (241), Expect = 1.2e-17 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU139755 vs. NCBI nr
Match: gi|659108741|ref|XP_008454365.1| (PREDICTED: protein GAMETE EXPRESSED 1 [Cucumis melo]) HSP 1 Score: 78.6 bits (192), Expect = 5.8e-12 Identity = 39/48 (81.25%), Postives = 44/48 (91.67%), Query Frame = 3
BLAST of CU139755 vs. NCBI nr
Match: gi|700197637|gb|KGN52795.1| (hypothetical protein Csa_4G001620 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 8.4e-11 Identity = 37/48 (77.08%), Postives = 43/48 (89.58%), Query Frame = 3
BLAST of CU139755 vs. NCBI nr
Match: gi|449469316|ref|XP_004152367.1| (PREDICTED: protein GAMETE EXPRESSED 1 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 8.4e-11 Identity = 37/48 (77.08%), Postives = 43/48 (89.58%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|