|
The following sequences are available for this feature:
transcribed_cluster sequence ATTGTTCTTACTCGGAGCTGCCGCCACCGCCTCCGCCACCGTTTTATAATTTCCACTTCCATCCGCCGCCACCACAGCCCCGC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
The following terms have been associated with this transcribed_cluster:
Vocabulary: Cellular Component
Term | Definition |
GO:0005618 | cell wall |
Vocabulary: Molecular Function
Term | Definition |
GO:0030599 | pectinesterase activity |
Vocabulary: Biological Process
Term | Definition |
GO:0042545 | cell wall modification |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
biological_process |
GO:0042545 |
cell wall modification |
cellular_component |
GO:0005618 |
cell wall |
molecular_function |
GO:0030599 |
pectinesterase activity |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Feature Name | Unique Name | Type |
G0073061 | G0073061 | EST |
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
IPR000070 | Pectinesterase, catalytic | PFAM | PF01095 | Pectinesterase | coord: 3..27 score: 9. |
IPR011050 | Pectin lyase fold/virulence factor | unknown | SSF51126 | Pectin lyase-like | coord: 3..27 score: 1.0 |
IPR012334 | Pectin lyase fold | GENE3D | G3DSA:2.160.20.10 | | coord: 3..27 score: 1. |
|