CU141289 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAGGCCTTGAGGCATCTCTTTCATCGGATACCTTAAGCCAACAAAGTGTTTGGAGTGCCATTTCAAATTCTAAACTTCATTTGGCCACCTTCACTCAAGGTGGAAAGAACCTTTGTTTTGCAAATTGATAGCTCTAACTCTTCAAAAGTTGTGACCAACTCTTGCGTTTGCACCAATGGTGATCCAAATTGCCTCCAAGACACCCGA
BLAST of CU141289 vs. TrEMBL
Match: A0A0A0L644_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186670 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.3e-11 Identity = 37/39 (94.87%), Postives = 39/39 (100.00%), Query Frame = 2
BLAST of CU141289 vs. TrEMBL
Match: A0A0A0L644_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186670 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.0e-08 Identity = 29/34 (85.29%), Postives = 32/34 (94.12%), Query Frame = 3
HSP 2 Score: 59.7 bits (143), Expect = 1.6e-06 Identity = 27/39 (69.23%), Postives = 33/39 (84.62%), Query Frame = 2
BLAST of CU141289 vs. TrEMBL
Match: A0A0A0K853_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G028440 PE=3 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.6e-04 Identity = 21/28 (75.00%), Postives = 25/28 (89.29%), Query Frame = 3
BLAST of CU141289 vs. NCBI nr
Match: gi|700202307|gb|KGN57440.1| (hypothetical protein Csa_3G186670 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 3.1e-11 Identity = 37/39 (94.87%), Postives = 39/39 (100.00%), Query Frame = 2
BLAST of CU141289 vs. NCBI nr
Match: gi|659090006|ref|XP_008445780.1| (PREDICTED: uncharacterized protein LOC103488703 [Cucumis melo]) HSP 1 Score: 62.4 bits (150), Expect = 3.6e-07 Identity = 30/39 (76.92%), Postives = 34/39 (87.18%), Query Frame = 2
BLAST of CU141289 vs. NCBI nr
Match: gi|778721997|ref|XP_011658389.1| (PREDICTED: uncharacterized protein LOC101207450 [Cucumis sativus]) HSP 1 Score: 58.9 bits (141), Expect = 4.0e-06 Identity = 27/39 (69.23%), Postives = 33/39 (84.62%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|