CU146189 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGCTGGGTAGGACTATTTGATGAAACTGCAGGAGGCCTTTGAGGAAACTGGACTCCGGCACTCACCAAATCATAATATGCTGAATAATACTGAGGGAACTTTCCAGAAGCACCGCCAAGAGCTGTCTGTGTGGCATCTAGAAGAAGAAATATTCTCTCTCGCACTGGTAAATCAGACTTTTTCTTCACTATCTTCACAAGAATAGGGAGAACCCCTGAATCAATCACCTGCTTATGTATTG
BLAST of CU146189 vs. TrEMBL
Match: V7CSK6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_002G278000g PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 6.0e-21 Identity = 54/80 (67.50%), Postives = 59/80 (73.75%), Query Frame = -3
BLAST of CU146189 vs. TrEMBL
Match: A0A068VD20_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00009831001 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 1.9e-19 Identity = 50/78 (64.10%), Postives = 57/78 (73.08%), Query Frame = -3
BLAST of CU146189 vs. TrEMBL
Match: V7AWY1_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_009G157500g PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 3.3e-19 Identity = 52/80 (65.00%), Postives = 59/80 (73.75%), Query Frame = -3
BLAST of CU146189 vs. TrEMBL
Match: A0A118JZW6_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_021259 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.3e-19 Identity = 54/80 (67.50%), Postives = 58/80 (72.50%), Query Frame = -3
BLAST of CU146189 vs. TrEMBL
Match: A5AKE4_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_030890 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.1e-18 Identity = 56/111 (50.45%), Postives = 64/111 (57.66%), Query Frame = -3
BLAST of CU146189 vs. NCBI nr
Match: gi|449449813|ref|XP_004142659.1| (PREDICTED: target of Myb protein 1 isoform X1 [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 1.1e-28 Identity = 68/80 (85.00%), Postives = 68/80 (85.00%), Query Frame = -3
BLAST of CU146189 vs. NCBI nr
Match: gi|700199333|gb|KGN54491.1| (hypothetical protein Csa_4G338950 [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 1.1e-28 Identity = 68/80 (85.00%), Postives = 68/80 (85.00%), Query Frame = -3
BLAST of CU146189 vs. NCBI nr
Match: gi|659069348|ref|XP_008449359.1| (PREDICTED: LOW QUALITY PROTEIN: TOM1-like protein 1 [Cucumis melo]) HSP 1 Score: 132.1 bits (331), Expect = 4.3e-28 Identity = 67/79 (84.81%), Postives = 67/79 (84.81%), Query Frame = -3
BLAST of CU146189 vs. NCBI nr
Match: gi|1009125549|ref|XP_015879670.1| (PREDICTED: TOM1-like protein 2 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 124.8 bits (312), Expect = 6.8e-26 Identity = 62/80 (77.50%), Postives = 65/80 (81.25%), Query Frame = -3
BLAST of CU146189 vs. NCBI nr
Match: gi|1009125547|ref|XP_015879669.1| (PREDICTED: TOM1-like protein 2 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 124.8 bits (312), Expect = 6.8e-26 Identity = 62/80 (77.50%), Postives = 65/80 (81.25%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|