CU147315 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGTGACACTACTTTGAGCTTTGAATTGTTTTTGGCTTTGGAGGAAGAAAATCTTCTGGATGTGAGGTTGCTTTAAATGACCTCAACTTCAACTTCAGTTACTCTCCAGATGATGGATGTAGACTGGTACTTGGACTTGGTCCAACTCCAAGTGCTAACTGTGATGATTATTACATGTTGGATATAATAAGGCTAAGGCACAAGTTGCATCTCTACCAGAGGAATATCACCGAGTGACTCAGTAT
BLAST of CU147315 vs. TrEMBL
Match: A0A0A0LI30_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G122020 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.6e-21 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU147315 vs. TrEMBL
Match: A0A0A0LI30_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G122020 PE=4 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 1.1e+02 Identity = 15/17 (88.24%), Postives = 16/17 (94.12%), Query Frame = 3
HSP 2 Score: 66.6 bits (161), Expect = 1.6e-08 Identity = 30/66 (45.45%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CU147315 vs. TrEMBL
Match: A5B6J0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_015279 PE=4 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.6e-08 Identity = 30/66 (45.45%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CU147315 vs. TrEMBL
Match: B9RIZ1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1752370 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 26/48 (54.17%), Postives = 35/48 (72.92%), Query Frame = 1
BLAST of CU147315 vs. TrEMBL
Match: B9GZS4_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0003s01750g PE=4 SV=2) HSP 1 Score: 62.0 bits (149), Expect = 3.8e-07 Identity = 29/51 (56.86%), Postives = 35/51 (68.63%), Query Frame = 1
BLAST of CU147315 vs. NCBI nr
Match: gi|449442343|ref|XP_004138941.1| (PREDICTED: delta-like protein C [Cucumis sativus]) HSP 1 Score: 111.3 bits (277), Expect = 7.9e-22 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU147315 vs. NCBI nr
Match: gi|659114614|ref|XP_008457144.1| (PREDICTED: uncharacterized protein LOC103496890 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 46/48 (95.83%), Postives = 47/48 (97.92%), Query Frame = 1
BLAST of CU147315 vs. NCBI nr
Match: gi|147858797|emb|CAN82910.1| (hypothetical protein VITISV_015279 [Vitis vinifera]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 30/66 (45.45%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CU147315 vs. NCBI nr
Match: gi|296086804|emb|CBI32953.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 30/66 (45.45%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CU147315 vs. NCBI nr
Match: gi|359494917|ref|XP_002271060.2| (PREDICTED: uncharacterized protein LOC100249189 [Vitis vinifera]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 30/66 (45.45%), Postives = 40/66 (60.61%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|