CU147651 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATCCAATAATTCATTATCTTTTTCATTCCCAACATGAACACTTCACTTTCCTCTGTTTTTCTCTTCCTAACAATCTTCACTTCCCTTCAATTCCCTTCAATTCTCTCTCGCAAGTTAACACCATCTTCCTATTCCACTTCCATCTTCGATGTCTCTGCCTCACAAACCAGCCTAGAT
BLAST of CU147651 vs. TrEMBL
Match: A0A0A0LPJ3_CUCSA (Aspartic proteinase nepenthesin-1 OS=Cucumis sativus GN=Csa_1G022490 PE=3 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.2e-13 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 3
BLAST of CU147651 vs. TrEMBL
Match: A0A0A0LS14_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G022480 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 3.7e-07 Identity = 34/44 (77.27%), Postives = 35/44 (79.55%), Query Frame = 3
BLAST of CU147651 vs. NCBI nr
Match: gi|449440933|ref|XP_004138238.1| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1-like [Cucumis sativus]) HSP 1 Score: 77.8 bits (190), Expect = 7.1e-12 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 3
BLAST of CU147651 vs. NCBI nr
Match: gi|659106559|ref|XP_008453384.1| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1-like [Cucumis melo]) HSP 1 Score: 65.1 bits (157), Expect = 4.7e-08 Identity = 38/43 (88.37%), Postives = 38/43 (88.37%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|