CU147918 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTTGGCTGCGCGCTGAAACCAAACTTGAGAAGAAGAAGAAGCTACCAATTCAACCTCCATCCAACAATCAGAAGATTGTTTCTCCTTTCGGTTCGTCTCCTTTCATGTCTTCCAGACATATGGCTTATTATCGTTAGCTTTCGATTTAGTAGTATTATTTTGGGCATAGAATCTAAGAACTGTATTATGATTGACTCTACTTTACCATTGTTTTAGATCGAAATTGATCTAAATTATAATGGTAAAAGTAAGAAAAAGTGAGGTTGATAACG
BLAST of CU147918 vs. Swiss-Prot
Match: AB19I_ARATH (ABC transporter I family member 19 OS=Arabidopsis thaliana GN=ABCI19 PE=2 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.4e-06 Identity = 27/45 (60.00%), Postives = 29/45 (64.44%), Query Frame = 1
BLAST of CU147918 vs. TrEMBL
Match: L7Y071_CUCSA (ABC transporter I family member 19 OS=Cucumis sativus GN=ABCA19 PE=2 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.6e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 1
BLAST of CU147918 vs. TrEMBL
Match: B9H8P6_POPTR (ABC transporter family protein OS=Populus trichocarpa GN=POPTR_0005s24830g PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.9e-09 Identity = 34/45 (75.56%), Postives = 37/45 (82.22%), Query Frame = 1
BLAST of CU147918 vs. TrEMBL
Match: V4T9R0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10021439mg PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.3e-08 Identity = 33/45 (73.33%), Postives = 37/45 (82.22%), Query Frame = 1
BLAST of CU147918 vs. TrEMBL
Match: A0A097P9U8_HEVBR (ABC transporter family protein OS=Hevea brasiliensis GN=ABCI19 PE=2 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.9e-08 Identity = 32/45 (71.11%), Postives = 37/45 (82.22%), Query Frame = 1
BLAST of CU147918 vs. TrEMBL
Match: B9GRP1_POPTR (ABC transporter family protein OS=Populus trichocarpa GN=POPTR_0002s03760g PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 6.7e-08 Identity = 33/45 (73.33%), Postives = 35/45 (77.78%), Query Frame = 1
BLAST of CU147918 vs. NCBI nr
Match: gi|525507322|ref|NP_001267701.1| (ABC transporter I family member 19-like [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 3.9e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 1
BLAST of CU147918 vs. NCBI nr
Match: gi|659116500|ref|XP_008458101.1| (PREDICTED: ABC transporter I family member 19-like isoform X1 [Cucumis melo]) HSP 1 Score: 86.7 bits (213), Expect = 2.4e-14 Identity = 43/46 (93.48%), Postives = 43/46 (93.48%), Query Frame = 1
BLAST of CU147918 vs. NCBI nr
Match: gi|224082840|ref|XP_002306861.1| (ABC transporter family protein [Populus trichocarpa]) HSP 1 Score: 67.0 bits (162), Expect = 1.9e-08 Identity = 34/45 (75.56%), Postives = 37/45 (82.22%), Query Frame = 1
BLAST of CU147918 vs. NCBI nr
Match: gi|567902640|ref|XP_006443808.1| (hypothetical protein CICLE_v10021439mg [Citrus clementina]) HSP 1 Score: 66.2 bits (160), Expect = 3.3e-08 Identity = 33/45 (73.33%), Postives = 37/45 (82.22%), Query Frame = 1
BLAST of CU147918 vs. NCBI nr
Match: gi|743919987|ref|XP_011004029.1| (PREDICTED: ABC transporter I family member 19-like [Populus euphratica]) HSP 1 Score: 65.5 bits (158), Expect = 5.6e-08 Identity = 33/45 (73.33%), Postives = 37/45 (82.22%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|