CU149724 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAGTGGAAACTTTAGTAAGGGCCCAACAGATTGTCTAGTAAGTAGGTAACCGGTTGACAGAATGCGTCAGTGTAGAGAAGGAGGCAGACAAGGAACCAGAGACTGATATTCCAAAAGAACCTGCTGAACTACCAAAGAAAGAAGCTCCGGCAATTGAGGTAGTTCCA
BLAST of CU149724 vs. TrEMBL
Match: A0A0A0LW81_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G560760 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 2.7e-12 Identity = 37/38 (97.37%), Postives = 38/38 (100.00%), Query Frame = 3
BLAST of CU149724 vs. NCBI nr
Match: gi|778662174|ref|XP_004135572.2| (PREDICTED: nestin-like isoform X2 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-10 Identity = 37/38 (97.37%), Postives = 38/38 (100.00%), Query Frame = 3
BLAST of CU149724 vs. NCBI nr
Match: gi|700210897|gb|KGN65993.1| (hypothetical protein Csa_1G560760 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-10 Identity = 37/38 (97.37%), Postives = 38/38 (100.00%), Query Frame = 3
BLAST of CU149724 vs. NCBI nr
Match: gi|778662171|ref|XP_011659466.1| (PREDICTED: nestin-like isoform X1 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-10 Identity = 37/38 (97.37%), Postives = 38/38 (100.00%), Query Frame = 3
BLAST of CU149724 vs. NCBI nr
Match: gi|659099260|ref|XP_008450510.1| (PREDICTED: titin-like isoform X2 [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 4.9e-07 Identity = 32/38 (84.21%), Postives = 34/38 (89.47%), Query Frame = 3
BLAST of CU149724 vs. NCBI nr
Match: gi|659099258|ref|XP_008450509.1| (PREDICTED: titin-like isoform X1 [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 4.9e-07 Identity = 32/38 (84.21%), Postives = 34/38 (89.47%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|