CU149730 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGACGCAAATTCCCAGCAGATAGAGCCTCAGCAGCATCAGCATTACGTTGGTCATCGTCGAGGGTGCTACCATACTCGCTCTTGATGGACCATGAGTCAGCAGCCACTGAGCGATCATCGTCAAGAGACTAGATCAACGGCGGACGGAGCAGCACGAGCCTGCTGCAACA
BLAST of CU149730 vs. TrEMBL
Match: A0A0A0L6T8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G187230 PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 1.9e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU149730 vs. TrEMBL
Match: M5XCP5_PRUPE (Protein-lysine N-methyltransferase PRUPE_ppa008451mg OS=Prunus persica GN=PRUPE_ppa008451mg PE=3 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 8.0e-12 Identity = 37/40 (92.50%), Postives = 39/40 (97.50%), Query Frame = -1
BLAST of CU149730 vs. TrEMBL
Match: W9S0Z4_9ROSA (Protein-lysine N-methyltransferase L484_027123 OS=Morus notabilis GN=L484_027123 PE=3 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 8.0e-12 Identity = 36/40 (90.00%), Postives = 39/40 (97.50%), Query Frame = -1
BLAST of CU149730 vs. TrEMBL
Match: V7B0Y7_PHAVU (Protein-lysine N-methyltransferase PHAVU_008G009300g OS=Phaseolus vulgaris GN=PHAVU_008G009300g PE=3 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 37/40 (92.50%), Postives = 38/40 (95.00%), Query Frame = -1
BLAST of CU149730 vs. TrEMBL
Match: A0A0L9TDE4_PHAAN (Protein-lysine N-methyltransferase LR48_Vigan549s009300 OS=Phaseolus angularis GN=LR48_Vigan549s009300 PE=3 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 37/40 (92.50%), Postives = 38/40 (95.00%), Query Frame = -1
BLAST of CU149730 vs. NCBI nr
Match: gi|449445949|ref|XP_004140734.1| (PREDICTED: methyltransferase-like protein 10 isoform X2 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 6.1e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU149730 vs. NCBI nr
Match: gi|778679869|ref|XP_011651204.1| (PREDICTED: methyltransferase-like protein 10 isoform X1 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 6.1e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU149730 vs. NCBI nr
Match: gi|700202315|gb|KGN57448.1| (hypothetical protein Csa_3G187230 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 6.1e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU149730 vs. NCBI nr
Match: gi|659114543|ref|XP_008457104.1| (PREDICTED: methyltransferase-like protein 10 [Cucumis melo]) HSP 1 Score: 81.3 bits (199), Expect = 6.1e-13 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = -1
BLAST of CU149730 vs. NCBI nr
Match: gi|729298792|ref|XP_010552063.1| (PREDICTED: uncharacterized protein LOC104822507 [Tarenaya hassleriana]) HSP 1 Score: 76.6 bits (187), Expect = 1.5e-11 Identity = 37/40 (92.50%), Postives = 40/40 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|