CU151977 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGAATCTTCGGAGAAAAAGACGAGAAGAAGACCCATTCCCCAATTGTCACCGGCAGTGGATTTGGATTTTCCGGTGAGAGTGAGACCCATTCGTTTTTAGTTGTTCAATGGGGGATTTGGGATTGGC
BLAST of CU151977 vs. TrEMBL
Match: A0A0A0KWA6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G162850 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 4.0e-08 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -2
BLAST of CU151977 vs. NCBI nr
Match: gi|449466873|ref|XP_004151150.1| (PREDICTED: uncharacterized protein LOC101208268 [Cucumis sativus]) HSP 1 Score: 64.7 bits (156), Expect = 4.4e-08 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -2
BLAST of CU151977 vs. NCBI nr
Match: gi|659121692|ref|XP_008460778.1| (PREDICTED: uncharacterized protein LOC103499540 [Cucumis melo]) HSP 1 Score: 63.2 bits (152), Expect = 1.3e-07 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|