CU155265 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGAAGAGAAGTGGGAATACTTTTATTCAATAAGACCAGAGAATGTCCTTTTGGAGACATTTCCTACACAGCTTCAAGCGACGAAAAGTCACGGCAGTTTTGAACGTATTGTCAAGTCATTCTCCAGATGAAGAGTATATGGGAAAAGATATTGAAGCAGCATGGGCTGATGACCTTTT
BLAST of CU155265 vs. TrEMBL
Match: A0A125S6K7_CUCME (Lipoxygenase OS=Cucumis melo var. makuwa GN=LOX10 PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-07 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 3
BLAST of CU155265 vs. TrEMBL
Match: A0A125S6K7_CUCME (Lipoxygenase OS=Cucumis melo var. makuwa GN=LOX10 PE=2 SV=1) HSP 1 Score: 45.4 bits (106), Expect = 2.7e-02 Identity = 22/28 (78.57%), Postives = 25/28 (89.29%), Query Frame = 2
BLAST of CU155265 vs. NCBI nr
Match: gi|778693116|ref|XP_004142135.2| (PREDICTED: linoleate 13S-lipoxygenase 2-1, chloroplastic-like [Cucumis sativus]) HSP 1 Score: 67.4 bits (163), Expect = 9.4e-09 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 3
BLAST of CU155265 vs. NCBI nr
Match: gi|659097665|ref|XP_008449747.1| (PREDICTED: linoleate 13S-lipoxygenase 2-1, chloroplastic-like [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 1.4e-07 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 3
BLAST of CU155265 vs. NCBI nr
Match: gi|987644663|gb|AME15768.1| (lipoxygenase 10 [Cucumis melo var. makuwa]) HSP 1 Score: 63.5 bits (153), Expect = 1.4e-07 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|