CU157041 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAGTGTCCACGTACGGTATTGGCCGTAAGGCGAAGTGGTCTGTGGGCAGTTGAAAAGCTCACAGAGGCCTATGATTGGCAAAGCAGAAGAGACCAATGATTTAACCAAGACATCATGTGTGAAGAGTGTGGCCCATGTCTGCCTCAGAATCACCGTCCACGTCACGTTTATTCCACCTATCACAATGCG
BLAST of CU157041 vs. Swiss-Prot
Match: DTX54_ARATH (Protein DETOXIFICATION 54 OS=Arabidopsis thaliana GN=DTX54 PE=2 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.3e-11 Identity = 31/50 (62.00%), Postives = 37/50 (74.00%), Query Frame = -1
BLAST of CU157041 vs. Swiss-Prot
Match: DTX50_ARATH (Protein DETOXIFICATION 50 OS=Arabidopsis thaliana GN=DTX50 PE=2 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 3.9e-08 Identity = 27/51 (52.94%), Postives = 31/51 (60.78%), Query Frame = -1
BLAST of CU157041 vs. Swiss-Prot
Match: DTX48_ARATH (Protein DETOXIFICATION 48 OS=Arabidopsis thaliana GN=DTX48 PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 8.6e-08 Identity = 26/51 (50.98%), Postives = 32/51 (62.75%), Query Frame = -1
BLAST of CU157041 vs. Swiss-Prot
Match: DTX49_ARATH (Protein DETOXIFICATION 49 OS=Arabidopsis thaliana GN=DTX49 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 1.6e-06 Identity = 24/49 (48.98%), Postives = 31/49 (63.27%), Query Frame = -1
BLAST of CU157041 vs. TrEMBL
Match: A0A0A0K9E2_CUCSA (Protein DETOXIFICATION OS=Cucumis sativus GN=Csa_7G290540 PE=3 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.1e-20 Identity = 53/57 (92.98%), Postives = 54/57 (94.74%), Query Frame = -1
BLAST of CU157041 vs. TrEMBL
Match: B9IQL5_POPTR (Protein DETOXIFICATION OS=Populus trichocarpa GN=POPTR_0019s11600g PE=3 SV=2) HSP 1 Score: 81.3 bits (199), Expect = 4.8e-13 Identity = 38/50 (76.00%), Postives = 42/50 (84.00%), Query Frame = -1
BLAST of CU157041 vs. TrEMBL
Match: W9QXM8_9ROSA (Protein DETOXIFICATION OS=Morus notabilis GN=L484_016430 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 6.2e-13 Identity = 38/50 (76.00%), Postives = 43/50 (86.00%), Query Frame = -1
BLAST of CU157041 vs. TrEMBL
Match: A0A067K258_JATCU (Protein DETOXIFICATION OS=Jatropha curcas GN=JCGZ_17156 PE=3 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.1e-12 Identity = 39/50 (78.00%), Postives = 41/50 (82.00%), Query Frame = -1
BLAST of CU157041 vs. TrEMBL
Match: A0A0D2Q981_GOSRA (Protein DETOXIFICATION OS=Gossypium raimondii GN=B456_006G131300 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.0e-12 Identity = 38/50 (76.00%), Postives = 41/50 (82.00%), Query Frame = -1
BLAST of CU157041 vs. NCBI nr
Match: gi|778726413|ref|XP_011659097.1| (PREDICTED: MATE efflux family protein 5 [Cucumis sativus]) HSP 1 Score: 105.9 bits (263), Expect = 2.6e-20 Identity = 53/57 (92.98%), Postives = 54/57 (94.74%), Query Frame = -1
BLAST of CU157041 vs. NCBI nr
Match: gi|659123040|ref|XP_008461457.1| (PREDICTED: MATE efflux family protein 5 [Cucumis melo]) HSP 1 Score: 102.1 bits (253), Expect = 3.7e-19 Identity = 52/57 (91.23%), Postives = 52/57 (91.23%), Query Frame = -1
BLAST of CU157041 vs. NCBI nr
Match: gi|566240979|ref|XP_002326006.2| (hypothetical protein POPTR_0019s11600g [Populus trichocarpa]) HSP 1 Score: 79.7 bits (195), Expect = 2.0e-12 Identity = 38/50 (76.00%), Postives = 42/50 (84.00%), Query Frame = -1
BLAST of CU157041 vs. NCBI nr
Match: gi|703093192|ref|XP_010094848.1| (Multidrug and toxin extrusion protein 1 [Morus notabilis]) HSP 1 Score: 79.3 bits (194), Expect = 2.6e-12 Identity = 38/50 (76.00%), Postives = 43/50 (86.00%), Query Frame = -1
BLAST of CU157041 vs. NCBI nr
Match: gi|743917031|ref|XP_011002496.1| (PREDICTED: MATE efflux family protein 5-like isoform X1 [Populus euphratica]) HSP 1 Score: 79.3 bits (194), Expect = 2.6e-12 Identity = 38/50 (76.00%), Postives = 42/50 (84.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|