CU161449 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGAGGTAGTAGTAGTCCGTGGCAATGGGAATGTGGATTCGACAAATATGAGAAGACGCTTACAAACTGTGGGTAAGGACACACCTCAACGAAAGAGACATATTTAGTAAAACAGATAAAGATTTGGAAAACTATGATTAGTTAGAACGAACATAATTGAGAAGATGGGTTTAAGGTTAGGTGGGAAAATGATTTTGGTGGAAGATAGTTGATGTATTTATGCATTCAC
BLAST of CU161449 vs. TrEMBL
Match: A0A0A0L0N0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G290730 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.5e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 3
BLAST of CU161449 vs. NCBI nr
Match: gi|778693140|ref|XP_011653584.1| (PREDICTED: uncharacterized protein LOC101212475 isoform X2 [Cucumis sativus]) HSP 1 Score: 71.6 bits (174), Expect = 6.4e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 3
BLAST of CU161449 vs. NCBI nr
Match: gi|778693136|ref|XP_011653583.1| (PREDICTED: uncharacterized protein LOC101212475 isoform X1 [Cucumis sativus]) HSP 1 Score: 71.6 bits (174), Expect = 6.4e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 3
BLAST of CU161449 vs. NCBI nr
Match: gi|659097651|ref|XP_008449739.1| (PREDICTED: uncharacterized protein LOC103491531 [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 7.4e-06 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|