CU163667 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTCCAAAAGTTGAAAATTCTATAGTCAACATCAGCTTTGCAAGAGTTGGTTCTTGCTTTCTGATAAGCTTAGCCCTTTATAAACGTCAAGCATTGGAAATGTCTTGTTCGAACGCTTGGAAGAATCTCCAGAAATAACTCC
BLAST of CU163667 vs. TrEMBL
Match: A0A0A0M3C6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G666460 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 8.2e-10 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = -1
BLAST of CU163667 vs. NCBI nr
Match: gi|449449675|ref|XP_004142590.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g04760, chloroplastic [Cucumis sativus]) HSP 1 Score: 70.9 bits (172), Expect = 6.9e-10 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = -1
BLAST of CU163667 vs. NCBI nr
Match: gi|659086091|ref|XP_008443759.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g04760, chloroplastic [Cucumis melo]) HSP 1 Score: 67.8 bits (164), Expect = 5.8e-09 Identity = 34/36 (94.44%), Postives = 34/36 (94.44%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|