CU165127 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGCCGAATCAGAGGGAATTGAATTCTTGTACAAATTCGGTAGATTATTACCTCCCTCACTTCCAAACATTTGCTCTCTAAAAAATGCGCCCGTCGGTGGTCGGTCAATTACCGACCTTCCTCCTGCAATTATATCTGAGATTTTGAACTGCCTTGATCCGAAGGAGCTTGGCATTGTGTCTTGTGTGTCTACTGTTCTTCATAGCATAGCATCTGAACACCATGTATGGAAGGAATTCTACAGCGA
BLAST of CU165127 vs. Swiss-Prot
Match: FBW3_ARATH (F-box/WD-40 repeat-containing protein At5g21040 OS=Arabidopsis thaliana GN=At5g21040 PE=2 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 1.7e-16 Identity = 43/70 (61.43%), Postives = 48/70 (68.57%), Query Frame = 3
BLAST of CU165127 vs. TrEMBL
Match: A0A0A0L0C6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G269200 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.9e-24 Identity = 62/81 (76.54%), Postives = 64/81 (79.01%), Query Frame = 3
BLAST of CU165127 vs. TrEMBL
Match: A0A061GUI8_THECC (F-box protein 2 OS=Theobroma cacao GN=TCM_041130 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.2e-16 Identity = 43/47 (91.49%), Postives = 45/47 (95.74%), Query Frame = 3
BLAST of CU165127 vs. TrEMBL
Match: A0A0D2RWE1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G079600 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 41/47 (87.23%), Postives = 46/47 (97.87%), Query Frame = 3
BLAST of CU165127 vs. TrEMBL
Match: V4LI88_EUTSA (Uncharacterized protein OS=Eutrema salsugineum GN=EUTSA_v10016076mg PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 5.9e-16 Identity = 47/74 (63.51%), Postives = 53/74 (71.62%), Query Frame = 3
BLAST of CU165127 vs. TrEMBL
Match: G7K2X0_MEDTR (F-box/WD-40 repeat plant protein OS=Medicago truncatula GN=MTR_5g087680 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 1.3e-15 Identity = 45/68 (66.18%), Postives = 50/68 (73.53%), Query Frame = 3
BLAST of CU165127 vs. NCBI nr
Match: gi|778692827|ref|XP_011653530.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis sativus]) HSP 1 Score: 119.8 bits (299), Expect = 2.2e-24 Identity = 62/81 (76.54%), Postives = 64/81 (79.01%), Query Frame = 3
BLAST of CU165127 vs. NCBI nr
Match: gi|659097885|ref|XP_008449867.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis melo]) HSP 1 Score: 115.2 bits (287), Expect = 5.5e-23 Identity = 64/88 (72.73%), Postives = 64/88 (72.73%), Query Frame = 3
BLAST of CU165127 vs. NCBI nr
Match: gi|1012202223|ref|XP_015973516.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Arachis duranensis]) HSP 1 Score: 94.7 bits (234), Expect = 7.7e-17 Identity = 42/48 (87.50%), Postives = 46/48 (95.83%), Query Frame = 3
BLAST of CU165127 vs. NCBI nr
Match: gi|1021534275|ref|XP_016164113.1| (PREDICTED: uncharacterized protein LOC107606580 [Arachis ipaensis]) HSP 1 Score: 94.7 bits (234), Expect = 7.7e-17 Identity = 42/48 (87.50%), Postives = 46/48 (95.83%), Query Frame = 3
BLAST of CU165127 vs. NCBI nr
Match: gi|590585792|ref|XP_007015527.1| (F-box protein 2 [Theobroma cacao]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 43/47 (91.49%), Postives = 45/47 (95.74%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|