CU168342 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGAGTTTTGAAAAAGGCGTGTTGAAACTGCCACTTCTAATTGTAGATGATAATACCGAAACAAATTTACTAAATGTGATGGCATTTGAGAAACTCCATGACGTTGGAAGTCAAGTGACATCTTTTGTAGTGTTGATGAATAATTTGATCGACATTGATAAAGATGTCGAGCTATTGTCGAATGATAATATAATAGCCAATGCACTTGGGAACAATGAAGAAGCGGCGAATTTGTTTAGTGTACTTGGGAAAG
BLAST of CU168342 vs. TrEMBL
Match: A0A0A0K9F5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G089270 PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.1e-24 Identity = 64/83 (77.11%), Postives = 65/83 (78.31%), Query Frame = 3
BLAST of CU168342 vs. TrEMBL
Match: A0A0A0KAA3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G091270 PE=4 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 5.9e-19 Identity = 54/61 (88.52%), Postives = 57/61 (93.44%), Query Frame = 3
BLAST of CU168342 vs. TrEMBL
Match: A0A0A0KAA3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G091270 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.7e-08 Identity = 37/61 (60.66%), Postives = 47/61 (77.05%), Query Frame = 3
HSP 2 Score: 92.8 bits (229), Expect = 2.1e-16 Identity = 53/83 (63.86%), Postives = 59/83 (71.08%), Query Frame = 3
BLAST of CU168342 vs. TrEMBL
Match: A5AFY5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_031339 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.9e-09 Identity = 34/59 (57.63%), Postives = 47/59 (79.66%), Query Frame = 3
BLAST of CU168342 vs. TrEMBL
Match: M1C2E5_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400022626 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.5e-09 Identity = 33/59 (55.93%), Postives = 46/59 (77.97%), Query Frame = 3
BLAST of CU168342 vs. NCBI nr
Match: gi|778711703|ref|XP_011656783.1| (PREDICTED: UPF0481 protein At3g47200-like [Cucumis sativus]) HSP 1 Score: 118.6 bits (296), Expect = 5.1e-24 Identity = 64/83 (77.11%), Postives = 65/83 (78.31%), Query Frame = 3
BLAST of CU168342 vs. NCBI nr
Match: gi|700191196|gb|KGN46400.1| (hypothetical protein Csa_6G089270 [Cucumis sativus]) HSP 1 Score: 118.6 bits (296), Expect = 5.1e-24 Identity = 64/83 (77.11%), Postives = 65/83 (78.31%), Query Frame = 3
BLAST of CU168342 vs. NCBI nr
Match: gi|700191199|gb|KGN46403.1| (hypothetical protein Csa_6G091270 [Cucumis sativus]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 54/61 (88.52%), Postives = 57/61 (93.44%), Query Frame = 3
BLAST of CU168342 vs. NCBI nr
Match: gi|659120434|ref|XP_008460192.1| (PREDICTED: uncharacterized protein LOC103499077 [Cucumis melo]) HSP 1 Score: 91.7 bits (226), Expect = 6.7e-16 Identity = 53/83 (63.86%), Postives = 59/83 (71.08%), Query Frame = 3
BLAST of CU168342 vs. NCBI nr
Match: gi|307135819|gb|ADN33691.1| (hypothetical protein [Cucumis melo subsp. melo]) HSP 1 Score: 91.7 bits (226), Expect = 6.7e-16 Identity = 53/83 (63.86%), Postives = 59/83 (71.08%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|