CU172035 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAATGACCCTCTGGAATGTTTGTATTAAGTCCTCTTCTCCATCCACTTGAAGTTCAAGGAAGCACCTATCCATCTTGTTAACAGTCAAGACAGGTCTAATCCTCTCTCCCAAAGCCTGACGGAGCACAGTCTCTGTTTGGACACAAAACACCTTCGATGCAATCCAACCACAACAAAGAGACAACCATCAGTAATACGCAAAGCA
BLAST of CU172035 vs. Swiss-Prot
Match: EF2_ARATH (Elongation factor 2 OS=Arabidopsis thaliana GN=LOS1 PE=1 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.2e-16 Identity = 44/48 (91.67%), Postives = 42/48 (87.50%), Query Frame = -1
BLAST of CU172035 vs. Swiss-Prot
Match: EF2_BETVU (Elongation factor 2 OS=Beta vulgaris PE=2 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 9.3e-16 Identity = 43/48 (89.58%), Postives = 42/48 (87.50%), Query Frame = -1
BLAST of CU172035 vs. Swiss-Prot
Match: EF2_PARKE (Elongation factor 2 OS=Parachlorella kessleri PE=2 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 1.6e-12 Identity = 36/48 (75.00%), Postives = 40/48 (83.33%), Query Frame = -1
BLAST of CU172035 vs. Swiss-Prot
Match: EF2_PICGU (Elongation factor 2 OS=Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324) GN=EFT2 PE=3 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 8.2e-12 Identity = 36/48 (75.00%), Postives = 38/48 (79.17%), Query Frame = -1
BLAST of CU172035 vs. Swiss-Prot
Match: EF2_DROME (Elongation factor 2 OS=Drosophila melanogaster GN=EF2 PE=1 SV=4) HSP 1 Score: 70.5 bits (171), Expect = 8.2e-12 Identity = 34/48 (70.83%), Postives = 39/48 (81.25%), Query Frame = -1
BLAST of CU172035 vs. TrEMBL
Match: A0A0S3SK93_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.07G219100 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.4e-15 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. TrEMBL
Match: M4DVJ8_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.4e-15 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. TrEMBL
Match: A9U245_PHYPA (Predicted protein OS=Physcomitrella patens subsp. patens GN=PHYPADRAFT_109208 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.4e-15 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. TrEMBL
Match: A0A0B2R4R9_GLYSO (Elongation factor 2 OS=Glycine soja GN=glysoja_011424 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.4e-15 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. TrEMBL
Match: A0A151R3J4_CAJCA (Elongation factor 2 OS=Cajanus cajan GN=KK1_041698 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.4e-15 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. NCBI nr
Match: gi|976916864|gb|KVI02359.1| (Elongation factor G, III-V domain-containing protein [Cynara cardunculus var. scolymus]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. NCBI nr
Match: gi|702366581|ref|XP_010060846.1| (PREDICTED: elongation factor 2 [Eucalyptus grandis]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. NCBI nr
Match: gi|778713730|ref|XP_011657107.1| (PREDICTED: elongation factor 2 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. NCBI nr
Match: gi|168065996|ref|XP_001784930.1| (predicted protein [Physcomitrella patens]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
BLAST of CU172035 vs. NCBI nr
Match: gi|674943192|emb|CDX90241.1| (BnaA08g17430D [Brassica napus]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 45/48 (93.75%), Postives = 45/48 (93.75%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|