WMU77892 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GATGAAGTTAGCATCAAGAAACTGCACTACTAGCTCTGAGCACAGTGTCTCCCCACAGAAAGAGGGTGTGAATGGGTGATCTGGTGAGTGCAGATACAAGAATAAGAACTTGTGTTCATCTTCTGCTATCTTCATGGCTTCTGGGAATCGACATGCGTAAAAAAAAGGGTGCATCGAGCCATACTGGTACTGGAAACTGGTGAGGAAAGACCATTCTTCCGGGACATTTTGGTGTGTCCTGCTGCAGAATCTGATATTGGTAACTGGATGGCAGAGTCTGGTTTCTTCTTCCTCCATTCATAACTCTTGAAAATCCTCCTAATATGTTTCTTGGAAGATTAACCATCCGTCGGACCATACTGTTGATTGAGGCCTCAGCTAATCTC
BLAST of WMU77892 vs. TAIR10
Match: AT4G10790.1 (AT4G10790.1 UBX domain-containing protein) HSP 1 Score: 72.0 bits (175), Expect = 3.0e-13 Identity = 36/78 (46.15%), Postives = 45/78 (57.69%), Query Frame = -3
BLAST of WMU77892 vs. Swiss-Prot
Match: PUX10_ARATH (Plant UBX domain-containing protein 10 OS=Arabidopsis thaliana GN=PUX10 PE=2 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 5.3e-12 Identity = 36/78 (46.15%), Postives = 45/78 (57.69%), Query Frame = -3
BLAST of WMU77892 vs. Swiss-Prot
Match: FAF2B_XENLA (FAS-associated factor 2-B OS=Xenopus laevis GN=faf2-b PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 6.4e-10 Identity = 30/81 (37.04%), Postives = 44/81 (54.32%), Query Frame = -3
BLAST of WMU77892 vs. Swiss-Prot
Match: FAF2A_XENLA (FAS-associated factor 2-A OS=Xenopus laevis GN=faf2-a PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.9e-09 Identity = 29/81 (35.80%), Postives = 45/81 (55.56%), Query Frame = -3
BLAST of WMU77892 vs. Swiss-Prot
Match: FAF2_XENTR (FAS-associated factor 2 OS=Xenopus tropicalis GN=faf2 PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.9e-09 Identity = 30/81 (37.04%), Postives = 44/81 (54.32%), Query Frame = -3
BLAST of WMU77892 vs. Swiss-Prot
Match: FAF2_HUMAN (FAS-associated factor 2 OS=Homo sapiens GN=FAF2 PE=1 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 4.2e-09 Identity = 29/81 (35.80%), Postives = 44/81 (54.32%), Query Frame = -3
BLAST of WMU77892 vs. NCBI nr
Match: gi|449469558|ref|XP_004152486.1| (PREDICTED: FAS-associated factor 2-like isoform X1 [Cucumis sativus]) HSP 1 Score: 155.6 bits (392), Expect = 5.8e-35 Identity = 70/75 (93.33%), Postives = 72/75 (96.00%), Query Frame = -3
BLAST of WMU77892 vs. NCBI nr
Match: gi|659067294|ref|XP_008438685.1| (PREDICTED: LOW QUALITY PROTEIN: FAS-associated factor 2-like [Cucumis melo]) HSP 1 Score: 154.8 bits (390), Expect = 9.9e-35 Identity = 69/75 (92.00%), Postives = 72/75 (96.00%), Query Frame = -3
BLAST of WMU77892 vs. NCBI nr
Match: gi|747051675|ref|XP_011071927.1| (PREDICTED: FAS-associated factor 2-like [Sesamum indicum]) HSP 1 Score: 140.2 bits (352), Expect = 2.5e-30 Identity = 58/75 (77.33%), Postives = 70/75 (93.33%), Query Frame = -3
BLAST of WMU77892 vs. NCBI nr
Match: gi|698534370|ref|XP_009763835.1| (PREDICTED: FAS-associated factor 2-like [Nicotiana sylvestris]) HSP 1 Score: 139.8 bits (351), Expect = 3.3e-30 Identity = 58/78 (74.36%), Postives = 70/78 (89.74%), Query Frame = -3
BLAST of WMU77892 vs. NCBI nr
Match: gi|297733741|emb|CBI14988.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 139.0 bits (349), Expect = 5.6e-30 Identity = 59/75 (78.67%), Postives = 67/75 (89.33%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|