WMU74927 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AACAACTTCAGGAAATTATTGCAATGTCTACATCTGTATCCAAAGATTCTGGGATATCAGCTGCATCAGTAGCAATCCAGCCTCCATCTCACCCTACCTATGATCTGCGTGGCATCATCCAGTTAGCCCTTGCAGAAGATTCTGCTGACTTTGGTATAATGGATTATTTTATTATTAACTATTTAGAAGACTATATGGTGATGTTTGGGATTACCTCACATTCATTGTGATCAAATTGCAACCGAAGAAATTAAAAAA
BLAST of WMU74927 vs. TAIR10
Match: AT2G01350.1 (AT2G01350.1 quinolinate phoshoribosyltransferase) HSP 1 Score: 49.3 bits (116), Expect = 1.4e-06 Identity = 23/49 (46.94%), Postives = 32/49 (65.31%), Query Frame = 3
BLAST of WMU74927 vs. NCBI nr
Match: gi|778730689|ref|XP_011659842.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 85.1 bits (209), Expect = 6.4e-14 Identity = 43/49 (87.76%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of WMU74927 vs. NCBI nr
Match: gi|659109569|ref|XP_008454775.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 84.7 bits (208), Expect = 8.3e-14 Identity = 43/49 (87.76%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of WMU74927 vs. NCBI nr
Match: gi|659109573|ref|XP_008454777.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 82.4 bits (202), Expect = 4.1e-13 Identity = 43/52 (82.69%), Postives = 46/52 (88.46%), Query Frame = 3
BLAST of WMU74927 vs. NCBI nr
Match: gi|659109575|ref|XP_008454778.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 79.7 bits (195), Expect = 2.7e-12 Identity = 40/44 (90.91%), Postives = 41/44 (93.18%), Query Frame = 3
BLAST of WMU74927 vs. NCBI nr
Match: gi|661896179|emb|CDP00757.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 63.5 bits (153), Expect = 2.0e-07 Identity = 26/47 (55.32%), Postives = 40/47 (85.11%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|