WMU73405 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AATTGCTGATTATGTGTCAGGTGGAATCGGAGCAAGCAGCGAAGAAGATAGATGAGATAATGGAAGTAGATGGGGTTGATTGTATTCAAAATGGGGCCATTGGATATGAGTGGAAGTATGGGATATCT
BLAST of WMU73405 vs. TAIR10
Match: AT4G10750.1 (AT4G10750.1 Phosphoenolpyruvate carboxylase family protein) HSP 1 Score: 50.8 bits (120), Expect = 2.3e-07 Identity = 25/46 (54.35%), Postives = 28/46 (60.87%), Query Frame = 3
BLAST of WMU73405 vs. NCBI nr
Match: gi|659095423|ref|XP_008448571.1| (PREDICTED: uncharacterized protein LOC103490709 [Cucumis melo]) HSP 1 Score: 64.7 bits (156), Expect = 4.4e-08 Identity = 33/46 (71.74%), Postives = 36/46 (78.26%), Query Frame = 3
BLAST of WMU73405 vs. NCBI nr
Match: gi|449456787|ref|XP_004146130.1| (PREDICTED: uncharacterized protein LOC101213205 [Cucumis sativus]) HSP 1 Score: 64.7 bits (156), Expect = 4.4e-08 Identity = 33/46 (71.74%), Postives = 36/46 (78.26%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|