WMU66390 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCGTTCACAAGTCCCCAAGTCAACTGAGTTTTCATATTTATGTTCATTCAGGCCTGCATCTTGAAGCAACTGAGACAATGCACGATAAGGGTGGAATACTACCAAATAATAGTCAAGGGCTTCTAAAATTTTCATTTCCATTTCCAGTATGTGTTTGATCTCATACTTGTACTTTTCATCAGATTGTATTTTTTTAATGTAAACACTGAG
BLAST of WMU66390 vs. TAIR10
Match: AT5G48630.2 (AT5G48630.2 Cyclin family protein) HSP 1 Score: 85.1 bits (209), Expect = 1.9e-17 Identity = 37/56 (66.07%), Postives = 48/56 (85.71%), Query Frame = -1
BLAST of WMU66390 vs. TAIR10
Match: AT5G48640.1 (AT5G48640.1 Cyclin family protein) HSP 1 Score: 82.4 bits (202), Expect = 1.2e-16 Identity = 39/56 (69.64%), Postives = 44/56 (78.57%), Query Frame = -1
BLAST of WMU66390 vs. Swiss-Prot
Match: CCC12_ARATH (Cyclin-C1-2 OS=Arabidopsis thaliana GN=CYCC1-2 PE=2 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.3e-16 Identity = 37/56 (66.07%), Postives = 48/56 (85.71%), Query Frame = -1
BLAST of WMU66390 vs. Swiss-Prot
Match: CCC11_ORYSJ (Cyclin-C1-1 OS=Oryza sativa subsp. japonica GN=Os09g0504400 PE=2 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.3e-16 Identity = 42/57 (73.68%), Postives = 47/57 (82.46%), Query Frame = -1
BLAST of WMU66390 vs. Swiss-Prot
Match: CCC11_ARATH (Cyclin-C1-1 OS=Arabidopsis thaliana GN=CYCC1-1 PE=2 SV=2) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-15 Identity = 39/56 (69.64%), Postives = 44/56 (78.57%), Query Frame = -1
BLAST of WMU66390 vs. NCBI nr
Match: gi|449459194|ref|XP_004147331.1| (PREDICTED: cyclin-C1-1 [Cucumis sativus]) HSP 1 Score: 104.8 bits (260), Expect = 6.4e-20 Identity = 53/56 (94.64%), Postives = 54/56 (96.43%), Query Frame = -1
BLAST of WMU66390 vs. NCBI nr
Match: gi|700207114|gb|KGN62233.1| (hypothetical protein Csa_2G337780 [Cucumis sativus]) HSP 1 Score: 104.8 bits (260), Expect = 6.4e-20 Identity = 53/56 (94.64%), Postives = 54/56 (96.43%), Query Frame = -1
BLAST of WMU66390 vs. NCBI nr
Match: gi|802546550|ref|XP_012085454.1| (PREDICTED: cyclin-C1-2-like isoform X1 [Jatropha curcas]) HSP 1 Score: 93.2 bits (230), Expect = 1.9e-16 Identity = 46/56 (82.14%), Postives = 52/56 (92.86%), Query Frame = -1
BLAST of WMU66390 vs. NCBI nr
Match: gi|802546552|ref|XP_012085462.1| (PREDICTED: cyclin-C1-2-like isoform X2 [Jatropha curcas]) HSP 1 Score: 93.2 bits (230), Expect = 1.9e-16 Identity = 46/56 (82.14%), Postives = 52/56 (92.86%), Query Frame = -1
BLAST of WMU66390 vs. NCBI nr
Match: gi|763741112|gb|KJB08611.1| (hypothetical protein B456_001G104300 [Gossypium raimondii]) HSP 1 Score: 92.4 bits (228), Expect = 3.3e-16 Identity = 45/56 (80.36%), Postives = 51/56 (91.07%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|