WMU65470 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TACACAAATCAAGAAACCGCCAACGACAATAACTTATTAAAGCTCTAAGTATTTGAGTTTTCCATCGAAGCCAGGCATAGGATTCCACACACGAACGCGAAACAAGATGGGATTCGACACGTACCGAAGCAGAGCACTCCACACGTGCCAAACACCAACCAGAAGAAACAGCGTCCCTGGAAGAACATGACCCCTTAAAAGATCCCATATCTTCAAAAGCGCTTTTACCACTCTATTTCTCCG
BLAST of WMU65470 vs. TAIR10
Match: AT1G32120.1 (AT1G32120.1 FUNCTIONS IN: molecular_function unknown) HSP 1 Score: 95.9 bits (237), Expect = 1.2e-20 Identity = 40/66 (60.61%), Postives = 55/66 (83.33%), Query Frame = -1
BLAST of WMU65470 vs. NCBI nr
Match: gi|449456761|ref|XP_004146117.1| (PREDICTED: transmembrane protein 45B [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 3.8e-24 Identity = 56/66 (84.85%), Postives = 61/66 (92.42%), Query Frame = -1
BLAST of WMU65470 vs. NCBI nr
Match: gi|659095474|ref|XP_008448600.1| (PREDICTED: transmembrane protein 45B [Cucumis melo]) HSP 1 Score: 119.0 bits (297), Expect = 3.8e-24 Identity = 56/66 (84.85%), Postives = 61/66 (92.42%), Query Frame = -1
BLAST of WMU65470 vs. NCBI nr
Match: gi|641819952|gb|KDO40079.1| (hypothetical protein CISIN_1g023730mg [Citrus sinensis]) HSP 1 Score: 107.8 bits (268), Expect = 8.8e-21 Identity = 49/65 (75.38%), Postives = 59/65 (90.77%), Query Frame = -1
BLAST of WMU65470 vs. NCBI nr
Match: gi|567880063|ref|XP_006432590.1| (hypothetical protein CICLE_v10002116mg [Citrus clementina]) HSP 1 Score: 107.8 bits (268), Expect = 8.8e-21 Identity = 49/65 (75.38%), Postives = 59/65 (90.77%), Query Frame = -1
BLAST of WMU65470 vs. NCBI nr
Match: gi|802615248|ref|XP_012075087.1| (PREDICTED: transmembrane protein 45B-like [Jatropha curcas]) HSP 1 Score: 107.5 bits (267), Expect = 1.1e-20 Identity = 46/66 (69.70%), Postives = 58/66 (87.88%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|