WMU63479 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAAAAGTAGGACCTAATCGAGTAAAATTCCTCGTAGCTCAGCAGCTCGCCGCCTTTTATTTTGATCGAGTTGGCCACTGTTTTTGTCCAACCATAATCTGATGCCAAATGAACCAAGCGCAACCAGAATTTGCCAGAGACCTCCGCAAAACCTCAATTGGGCGAGAACCCGTTACGTATTGGCAAGAAGTTT
BLAST of WMU63479 vs. NCBI nr
Match: gi|659099243|ref|XP_008450502.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 1.5e-07 Identity = 30/32 (93.75%), Postives = 31/32 (96.88%), Query Frame = -1
BLAST of WMU63479 vs. NCBI nr
Match: gi|449435585|ref|XP_004135575.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 5.7e-07 Identity = 28/32 (87.50%), Postives = 31/32 (96.88%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|