WMU58021 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGCAGGGTGGATATCTCTTGGTAATCAATTGAGTGGAGTGCGATTGGTTGATGAAGGGCTAAGAGCGAGGTTCAAGGCTGCATATCCAAATGTGGAGGTTCAA
BLAST of WMU58021 vs. TAIR10
Match: AT4G10760.1 (AT4G10760.1 mRNAadenosine methylase) HSP 1 Score: 62.0 bits (149), Expect = 8.2e-11 Identity = 26/34 (76.47%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of WMU58021 vs. Swiss-Prot
Match: MTA70_MEDTR (Putative N6-adenosine-methyltransferase MT-A70-like OS=Medicago truncatula GN=MtrDRAFT_AC148918g15v1 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 2.0e-11 Identity = 32/34 (94.12%), Postives = 32/34 (94.12%), Query Frame = 2
BLAST of WMU58021 vs. Swiss-Prot
Match: MTA70_ORYSJ (Probable N6-adenosine-methyltransferase MT-A70-like OS=Oryza sativa subsp. japonica GN=Os02g0672600 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 3.8e-10 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of WMU58021 vs. Swiss-Prot
Match: MTA70_ARATH (N6-adenosine-methyltransferase MT-A70-like OS=Arabidopsis thaliana GN=MTA PE=1 SV=2) HSP 1 Score: 62.0 bits (149), Expect = 1.5e-09 Identity = 26/34 (76.47%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of WMU58021 vs. NCBI nr
Match: gi|778674825|ref|XP_011650302.1| (PREDICTED: N6-adenosine-methyltransferase MT-A70-like [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 2
BLAST of WMU58021 vs. NCBI nr
Match: gi|700200543|gb|KGN55676.1| (hypothetical protein Csa_3G002950 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 2
BLAST of WMU58021 vs. NCBI nr
Match: gi|659095427|ref|XP_008448574.1| (PREDICTED: N6-adenosine-methyltransferase MT-A70-like [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 2
BLAST of WMU58021 vs. NCBI nr
Match: gi|357454611|ref|XP_003597586.1| (N6-adenosine-methyltransferase MT-A70-like protein [Medicago truncatula]) HSP 1 Score: 69.7 bits (169), Expect = 1.1e-09 Identity = 32/34 (94.12%), Postives = 34/34 (100.00%), Query Frame = 2
BLAST of WMU58021 vs. NCBI nr
Match: gi|645267795|ref|XP_008239238.1| (PREDICTED: N6-adenosine-methyltransferase MT-A70-like [Prunus mume]) HSP 1 Score: 69.7 bits (169), Expect = 1.1e-09 Identity = 32/34 (94.12%), Postives = 34/34 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|