WMU57138 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCTCTTCGAATGCTTGAATTGGACCATGGACTGATCAACTGCCCTTCACTTCACATATTTGGTAGTGATCAGGGAAACGATAGGCAGATTGCTAACAAAACGAGCAGAGAACTTGCTTCTTGTTTTGATGCAGGTTGTTCTGTGATTATCGAACACGACTGTGGTCACATAATCCCTACTCGACCTCCCTACATTGACGAGATAAAAGAGTTCCTTCAACGTTTTCTTTGGTTGGATTCATGAGTGTAACCTACAAGCATTGAAGTTTTTAGAGAGCTTGATCATACAAGGGATTATTTTTTATTTCTCGAAGAAAACGTTGGTTCACTCTTGGATTGTAACGG
BLAST of WMU57138 vs. TAIR10
Match: AT1G09280.1 (AT1G09280.1 Rhodanese-like (InterPro:IPR001763), Serine hydrolase (InterPro:IPR005645)) HSP 1 Score: 93.6 bits (231), Expect = 8.5e-20 Identity = 44/77 (57.14%), Postives = 54/77 (70.13%), Query Frame = 1
BLAST of WMU57138 vs. Swiss-Prot
Match: STR6_ARATH (Rhodanese-like domain-containing protein 6 OS=Arabidopsis thaliana GN=STR6 PE=2 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.5e-18 Identity = 44/77 (57.14%), Postives = 54/77 (70.13%), Query Frame = 1
BLAST of WMU57138 vs. NCBI nr
Match: gi|778659683|ref|XP_011654855.1| (PREDICTED: rhodanese-like domain-containing protein 6 isoform X1 [Cucumis sativus]) HSP 1 Score: 151.8 bits (382), Expect = 7.5e-34 Identity = 70/76 (92.11%), Postives = 71/76 (93.42%), Query Frame = 1
BLAST of WMU57138 vs. NCBI nr
Match: gi|659128662|ref|XP_008464312.1| (PREDICTED: rhodanese-like domain-containing protein 6 isoform X1 [Cucumis melo]) HSP 1 Score: 146.4 bits (368), Expect = 3.1e-32 Identity = 67/76 (88.16%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of WMU57138 vs. NCBI nr
Match: gi|703089848|ref|XP_010093919.1| (hypothetical protein L484_005601 [Morus notabilis]) HSP 1 Score: 130.6 bits (327), Expect = 1.8e-27 Identity = 60/75 (80.00%), Postives = 64/75 (85.33%), Query Frame = 1
BLAST of WMU57138 vs. NCBI nr
Match: gi|703095518|ref|XP_010095559.1| (hypothetical protein L484_007274 [Morus notabilis]) HSP 1 Score: 130.6 bits (327), Expect = 1.8e-27 Identity = 60/75 (80.00%), Postives = 64/75 (85.33%), Query Frame = 1
BLAST of WMU57138 vs. NCBI nr
Match: gi|641862954|gb|KDO81641.1| (hypothetical protein CISIN_1g007311mg [Citrus sinensis]) HSP 1 Score: 127.1 bits (318), Expect = 2.0e-26 Identity = 56/75 (74.67%), Postives = 61/75 (81.33%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|