WMU50800 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGATCACAAGTCTCATCAGGAGTGAGATCAGCAAAAGCGCTGGACTTCACGCTTTGGGTAGACAAGCACATGACCAGGAACAAGAGGACGGAGGTTGACCATGGCGTAAGAGAGACTGGTGCAGTAGAATACTTCCTTCGGATCAATCTTGTAACGCCCAAAACGTGTAGTGGTCTGATCCCATCTGCGGTAACGGAATGAAGGGTGAGAAGAATTTGATGAAGTGAAAAACACGGGTGATGAATTGAAAAACC
BLAST of WMU50800 vs. TAIR10
Match: AT5G58240.1 (AT5G58240.1 FRAGILE HISTIDINE TRIAD) HSP 1 Score: 70.9 bits (172), Expect = 4.3e-13 Identity = 33/43 (76.74%), Postives = 34/43 (79.07%), Query Frame = -3
BLAST of WMU50800 vs. Swiss-Prot
Match: FHIT_ARATH (Bifunctional bis(5'-adenosyl)-triphosphatase/adenylylsulfatase FHIT OS=Arabidopsis thaliana GN=FHIT PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.7e-12 Identity = 33/43 (76.74%), Postives = 34/43 (79.07%), Query Frame = -3
BLAST of WMU50800 vs. Swiss-Prot
Match: FHIT_DICDI (Bis(5'-adenosyl)-triphosphatase OS=Dictyostelium discoideum GN=fhit PE=3 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.0e-08 Identity = 27/46 (58.70%), Postives = 33/46 (71.74%), Query Frame = -3
BLAST of WMU50800 vs. Swiss-Prot
Match: FHIT_BOVIN (Bis(5'-adenosyl)-triphosphatase OS=Bos taurus GN=FHIT PE=2 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.6e-07 Identity = 26/44 (59.09%), Postives = 31/44 (70.45%), Query Frame = -3
BLAST of WMU50800 vs. Swiss-Prot
Match: FHIT_HUMAN (Bis(5'-adenosyl)-triphosphatase OS=Homo sapiens GN=FHIT PE=1 SV=3) HSP 1 Score: 55.8 bits (133), Expect = 2.6e-07 Identity = 26/44 (59.09%), Postives = 31/44 (70.45%), Query Frame = -3
BLAST of WMU50800 vs. Swiss-Prot
Match: FHIT_MOUSE (Bis(5'-adenosyl)-triphosphatase OS=Mus musculus GN=Fhit PE=1 SV=3) HSP 1 Score: 55.8 bits (133), Expect = 2.6e-07 Identity = 26/44 (59.09%), Postives = 31/44 (70.45%), Query Frame = -3
BLAST of WMU50800 vs. NCBI nr
Match: gi|778674779|ref|XP_011650292.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase isoform X2 [Cucumis sativus]) HSP 1 Score: 84.0 bits (206), Expect = 1.4e-13 Identity = 38/43 (88.37%), Postives = 40/43 (93.02%), Query Frame = -3
BLAST of WMU50800 vs. NCBI nr
Match: gi|802540666|ref|XP_012077692.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase [Jatropha curcas]) HSP 1 Score: 82.4 bits (202), Expect = 4.1e-13 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = -3
BLAST of WMU50800 vs. NCBI nr
Match: gi|118487777|gb|ABK95712.1| (unknown [Populus trichocarpa]) HSP 1 Score: 81.6 bits (200), Expect = 7.0e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = -3
BLAST of WMU50800 vs. NCBI nr
Match: gi|743896928|ref|XP_011041742.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase [Populus euphratica]) HSP 1 Score: 81.3 bits (199), Expect = 9.1e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = -3
BLAST of WMU50800 vs. NCBI nr
Match: gi|823247671|ref|XP_012456504.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase isoform X2 [Gossypium raimondii]) HSP 1 Score: 81.3 bits (199), Expect = 9.1e-13 Identity = 36/43 (83.72%), Postives = 39/43 (90.70%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|