WMU41466 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GCTCTCGATCTCCTCCTCGAGCTGCCTAGCTGACCGTTTCTCCGTTCCCTTGAAGATCATATGCTCGAGGAAATGAGCAGTGCCATTAGTCTCCTCGGTCTCGAACCTCGACCCGGCATCAATCCAAAACTCCAACCGTCGCAGTCCGAGCGGCAAGGTTTGACTCAGTGGCCACCCGGAGGCCATTGGGGAGAGTAGTAACGCGAGTTTCAGGCGCGGAGAGAATCCGGGGTATGGTCAGTGATGGTCGGGTGAGGCGAGCCGTATTTGAGAAACCTAGGGTCGGGATTCTCGAGCTGTTTGAGCTTGGATTTCACAGCCTCCGCGAGGCGATCGTAGATCATGGCATTGGGCGGCGGAGGAGAGGGAGGTGGAGAAGAAGAGGCTACCGCCGGGGAAGTGGAAGCCGATCTAATAGCCTGGTGGAAAGGAGGCAAAAGATCGCCGGTGAGAGGAGCGAGCGAGGGTGAGAAGACGCTTGATCGCCATGATTGATTTTGGGCCCTTGCTCCCTAGGGTTTACAGCGGCTACCCCC
BLAST of WMU41466 vs. TAIR10
Match: AT3G02090.2 (AT3G02090.2 Insulinase (Peptidase family M16) protein) HSP 1 Score: 78.2 bits (191), Expect = 5.8e-15 Identity = 40/64 (62.50%), Postives = 44/64 (68.75%), Query Frame = -3
HSP 2 Score: 62.8 bits (151), Expect = 2.5e-10 Identity = 31/33 (93.94%), Postives = 31/33 (93.94%), Query Frame = -2
HSP 3 Score: 55.8 bits (133), Expect = 3.1e-08 Identity = 23/37 (62.16%), Postives = 26/37 (70.27%), Query Frame = -1
BLAST of WMU41466 vs. Swiss-Prot
Match: MPPB_ARATH (Probable mitochondrial-processing peptidase subunit beta, mitochondrial OS=Arabidopsis thaliana GN=At3g02090 PE=2 SV=2) HSP 1 Score: 78.2 bits (191), Expect = 1.0e-13 Identity = 40/64 (62.50%), Postives = 44/64 (68.75%), Query Frame = -3
HSP 2 Score: 62.8 bits (151), Expect = 4.5e-09 Identity = 31/33 (93.94%), Postives = 31/33 (93.94%), Query Frame = -2
HSP 3 Score: 55.8 bits (133), Expect = 5.4e-07 Identity = 23/37 (62.16%), Postives = 26/37 (70.27%), Query Frame = -1
BLAST of WMU41466 vs. Swiss-Prot
Match: MPPB_NEUCR (Mitochondrial-processing peptidase subunit beta OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=pep PE=1 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 3.3e-12 Identity = 36/57 (63.16%), Postives = 42/57 (73.68%), Query Frame = -3
HSP 2 Score: 32.3 bits (72), Expect = 6.4e+00 Identity = 17/41 (41.46%), Postives = 24/41 (58.54%), Query Frame = -2
BLAST of WMU41466 vs. Swiss-Prot
Match: MPPB_LENED (Mitochondrial-processing peptidase subunit beta OS=Lentinula edodes GN=mppB PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 8.1e-11 Identity = 34/57 (59.65%), Postives = 40/57 (70.18%), Query Frame = -3
HSP 2 Score: 37.7 bits (86), Expect = 1.5e-01 Identity = 19/29 (65.52%), Postives = 20/29 (68.97%), Query Frame = -2
BLAST of WMU41466 vs. Swiss-Prot
Match: MPPB_BOVIN (Mitochondrial-processing peptidase subunit beta OS=Bos taurus GN=PMPCB PE=2 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 1.1e-10 Identity = 31/42 (73.81%), Postives = 33/42 (78.57%), Query Frame = -3
HSP 2 Score: 37.7 bits (86), Expect = 1.5e-01 Identity = 23/47 (48.94%), Postives = 29/47 (61.70%), Query Frame = -2
BLAST of WMU41466 vs. Swiss-Prot
Match: MPPB_RAT (Mitochondrial-processing peptidase subunit beta OS=Rattus norvegicus GN=Pmpcb PE=1 SV=3) HSP 1 Score: 68.2 bits (165), Expect = 1.1e-10 Identity = 31/42 (73.81%), Postives = 33/42 (78.57%), Query Frame = -3
HSP 2 Score: 36.6 bits (83), Expect = 3.4e-01 Identity = 19/33 (57.58%), Postives = 22/33 (66.67%), Query Frame = -2
BLAST of WMU41466 vs. NCBI nr
Match: gi|661902917|ref|NP_001284394.1| (probable mitochondrial-processing peptidase subunit beta [Cucumis melo]) HSP 1 Score: 88.6 bits (218), Expect = 1.2e-14 Identity = 44/66 (66.67%), Postives = 45/66 (68.18%), Query Frame = -1
BLAST of WMU41466 vs. NCBI nr
Match: gi|449438845|ref|XP_004137198.1| (PREDICTED: probable mitochondrial-processing peptidase subunit beta [Cucumis sativus]) HSP 1 Score: 88.6 bits (218), Expect = 1.2e-14 Identity = 44/66 (66.67%), Postives = 45/66 (68.18%), Query Frame = -1
BLAST of WMU41466 vs. NCBI nr
Match: gi|659101564|ref|XP_008451674.1| (PREDICTED: probable mitochondrial-processing peptidase subunit beta isoform X2 [Cucumis melo]) HSP 1 Score: 88.6 bits (218), Expect = 1.2e-14 Identity = 44/66 (66.67%), Postives = 45/66 (68.18%), Query Frame = -1
BLAST of WMU41466 vs. NCBI nr
Match: gi|823167118|ref|XP_012483507.1| (PREDICTED: probable mitochondrial-processing peptidase subunit beta isoform X2 [Gossypium raimondii]) HSP 1 Score: 86.7 bits (213), Expect = 4.6e-14 Identity = 46/65 (70.77%), Postives = 49/65 (75.38%), Query Frame = -3
BLAST of WMU41466 vs. NCBI nr
Match: gi|763766227|gb|KJB33442.1| (hypothetical protein B456_006G011200 [Gossypium raimondii]) HSP 1 Score: 86.7 bits (213), Expect = 4.6e-14 Identity = 46/65 (70.77%), Postives = 49/65 (75.38%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|