WMU39953 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCATAAAAGTGCTGCAGAAGCAATGGATACAGTACAGGAGCTGAAAAACTGCAATCTGTATCTTGTTGGTCGAACACCGGATGTCAATTCAACCTTTGTCTTAAACAGAAGTGACTGTCCGGAGCTTGGTCCAGTTGGGAACCTGTTGACTTCACCGAACTTCACGATTTCAGCGTCGGTTTTGGTGGTGCAGCAATATCGTTCTGAAGTTACTGGTGAATTCGGTTTCAGATTCTGCTGATGGAGAATCAGAATCATCATAAGTAGTGTGTTGGTTTCACATTCTTTTAGTTGCACATAGGAGAGCAGCATCTTTGTGAATCATAGGGTTAGATTTCCTGTTTTCTTTTTTGTTCAAGTATCAAATATGACTGGTGTTACTTAAAGCTCCAAATAACATTATCCTACATAGTCTAATCGGTCCTCTTCTAAAGGGGCTCTCTGACCTAAAACTAAGATAACAAGGATTTTTAAGTCATCATATTTTCAATTTGGGCTACAACTTATGGAGTGTATTGTCAAAAATAAAGGATGCTTTCATT
BLAST of WMU39953 vs. TAIR10
Match: AT5G41610.1 (AT5G41610.1 cation/H+ exchanger 18) HSP 1 Score: 62.8 bits (151), Expect = 2.5e-10 Identity = 30/65 (46.15%), Postives = 41/65 (63.08%), Query Frame = 2
BLAST of WMU39953 vs. TAIR10
Match: AT3G17630.1 (AT3G17630.1 cation/H+ exchanger 19) HSP 1 Score: 61.6 bits (148), Expect = 5.7e-10 Identity = 31/65 (47.69%), Postives = 43/65 (66.15%), Query Frame = 2
BLAST of WMU39953 vs. TAIR10
Match: AT4G23700.1 (AT4G23700.1 cation/H+ exchanger 17) HSP 1 Score: 59.7 bits (143), Expect = 2.1e-09 Identity = 33/67 (49.25%), Postives = 44/67 (65.67%), Query Frame = 2
BLAST of WMU39953 vs. TAIR10
Match: AT1G64170.1 (AT1G64170.1 cation/H+ exchanger 16) HSP 1 Score: 54.7 bits (130), Expect = 6.9e-08 Identity = 27/66 (40.91%), Postives = 40/66 (60.61%), Query Frame = 2
BLAST of WMU39953 vs. TAIR10
Match: AT2G31910.1 (AT2G31910.1 cation/H+ exchanger 21) HSP 1 Score: 50.1 bits (118), Expect = 1.7e-06 Identity = 31/73 (42.47%), Postives = 41/73 (56.16%), Query Frame = 2
BLAST of WMU39953 vs. Swiss-Prot
Match: CHX18_ARATH (Cation/H(+) antiporter 18 OS=Arabidopsis thaliana GN=CHX18 PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 4.5e-09 Identity = 30/65 (46.15%), Postives = 41/65 (63.08%), Query Frame = 2
BLAST of WMU39953 vs. Swiss-Prot
Match: CHX19_ARATH (Cation/H(+) antiporter 19 OS=Arabidopsis thaliana GN=CHX19 PE=2 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 1.0e-08 Identity = 31/65 (47.69%), Postives = 43/65 (66.15%), Query Frame = 2
BLAST of WMU39953 vs. Swiss-Prot
Match: CHX17_ARATH (Cation/H(+) antiporter 17 OS=Arabidopsis thaliana GN=CHX17 PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 3.8e-08 Identity = 33/67 (49.25%), Postives = 44/67 (65.67%), Query Frame = 2
BLAST of WMU39953 vs. Swiss-Prot
Match: CHX16_ARATH (Cation/H(+) antiporter 16 OS=Arabidopsis thaliana GN=CHX16 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 1.2e-06 Identity = 27/66 (40.91%), Postives = 40/66 (60.61%), Query Frame = 2
BLAST of WMU39953 vs. NCBI nr
Match: gi|449457680|ref|XP_004146576.1| (PREDICTED: cation/H(+) antiporter 18-like [Cucumis sativus]) HSP 1 Score: 118.6 bits (296), Expect = 1.1e-23 Identity = 56/69 (81.16%), Postives = 64/69 (92.75%), Query Frame = 2
BLAST of WMU39953 vs. NCBI nr
Match: gi|659102162|ref|XP_008451983.1| (PREDICTED: LOW QUALITY PROTEIN: cation/H(+) antiporter 18-like [Cucumis melo]) HSP 1 Score: 117.9 bits (294), Expect = 1.9e-23 Identity = 54/69 (78.26%), Postives = 63/69 (91.30%), Query Frame = 2
BLAST of WMU39953 vs. NCBI nr
Match: gi|645267268|ref|XP_008238994.1| (PREDICTED: cation/H(+) antiporter 18-like [Prunus mume]) HSP 1 Score: 84.3 bits (207), Expect = 2.3e-13 Identity = 41/70 (58.57%), Postives = 51/70 (72.86%), Query Frame = 2
BLAST of WMU39953 vs. NCBI nr
Match: gi|698541123|ref|XP_009765985.1| (PREDICTED: cation/H(+) antiporter 18-like [Nicotiana sylvestris]) HSP 1 Score: 84.3 bits (207), Expect = 2.3e-13 Identity = 41/73 (56.16%), Postives = 51/73 (69.86%), Query Frame = 2
BLAST of WMU39953 vs. NCBI nr
Match: gi|658012040|ref|XP_008341283.1| (PREDICTED: cation/H(+) antiporter 18-like [Malus domestica]) HSP 1 Score: 84.3 bits (207), Expect = 2.3e-13 Identity = 40/66 (60.61%), Postives = 50/66 (75.76%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|