CSPI01G19920.1 (mRNA) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.TACTTGATGAAACGGCTTCTT TACTTGATGAAACGGCTTCTT TACTTGATGAAACGGCTTCTT GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
|