CSPI04G13120 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCCCTGTTTCGAACACGTCGAGGACTAGATTCGGTGCAGTTCAAATGATCGACAACCCATTAACAGAAACTCAAGATCTTCCCAAGTCCAAACTATGGGGAAGAGCACAGGGTTTTTACGCGGCGGTGGCCGGCGGCTTCACAAGACCAATCTGGGTTGTTAATGGCGATGAATTTAGCGTTTGTGAGTGGGAAATACAATGGAAGCTCCGTCACCATATTTGGAAGAAACCCATTTATGGAGAAAGTGAGAGAGAGATGCCTGTGATTGGCGGAAGTGGGCTGTTTAGATTTGCGAGAGAGATGCCTGTGTGA ATGGCCCCTGTTTCGAACACGTCGAGGACTAGATTCGGTGCAGTTCAAATGATCGACAACCCATTAACAGAAACTCAAGATCTTCCCAAGTCCAAACTATGGGGAAGAGCACAGGGTTTTTACGCGGCGGTGGCCGGCGGCTTCACAAGACCAATCTGGGTTGTTAATGGCGATGAATTTAGCGTTTGTGAGTGGGAAATACAATGGAAGCTCCGTCACCATATTTGGAAGAAACCCATTTATGGAGAAAGTGAGAGAGAGATGCCTGTGATTGGCGGAAGTGGGCTGTTTAGATTTGCGAGAGAGATGCCTGTGTGA ATGGCCCCTGTTTCGAACACGTCGAGGACTAGATTCGGTGCAGTTCAAATGATCGACAACCCATTAACAGAAACTCAAGATCTTCCCAAGTCCAAACTATGGGGAAGAGCACAGGGTTTTTACGCGGCGGTGGCCGGCGGCTTCACAAGACCAATCTGGGTTGTTAATGGCGATGAATTTAGCGTTTGTGAGTGGGAAATACAATGGAAGCTCCGTCACCATATTTGGAAGAAACCCATTTATGGAGAAAGTGAGAGAGAGATGCCTGTGATTGGCGGAAGTGGGCTGTTTAGATTTGCGAGAGAGATGCCTGTGTGA
BLAST of CSPI04G13120 vs. Swiss-Prot
Match: DIR19_ARATH (Dirigent protein 19 OS=Arabidopsis thaliana GN=DIR19 PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.3e-12 Identity = 43/99 (43.43%), Postives = 57/99 (57.58%), Query Frame = 1
BLAST of CSPI04G13120 vs. Swiss-Prot
Match: DIR11_ARATH (Dirigent protein 11 OS=Arabidopsis thaliana GN=DIR11 PE=2 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.4e-10 Identity = 45/103 (43.69%), Postives = 56/103 (54.37%), Query Frame = 1
BLAST of CSPI04G13120 vs. Swiss-Prot
Match: DIR23_ARATH (Dirigent protein 23 OS=Arabidopsis thaliana GN=DIR23 PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 7.7e-09 Identity = 38/94 (40.43%), Postives = 50/94 (53.19%), Query Frame = 1
BLAST of CSPI04G13120 vs. Swiss-Prot
Match: DIR2_ARATH (Dirigent protein 2 OS=Arabidopsis thaliana GN=DIR2 PE=2 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-08 Identity = 41/100 (41.00%), Postives = 53/100 (53.00%), Query Frame = 1
BLAST of CSPI04G13120 vs. Swiss-Prot
Match: DIR1_ARATH (Dirigent protein 1 OS=Arabidopsis thaliana GN=DIR1 PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.8e-08 Identity = 40/101 (39.60%), Postives = 54/101 (53.47%), Query Frame = 1
BLAST of CSPI04G13120 vs. TrEMBL
Match: A0A0A0KWV5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G280620 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 9.8e-19 Identity = 53/88 (60.23%), Postives = 64/88 (72.73%), Query Frame = 1
BLAST of CSPI04G13120 vs. TrEMBL
Match: A0A0A0L1S2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G280630 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 3.1e-17 Identity = 54/99 (54.55%), Postives = 65/99 (65.66%), Query Frame = 1
BLAST of CSPI04G13120 vs. TrEMBL
Match: A0A0A0L0G5_CUCSA (Dirigent-like protein 2 OS=Cucumis sativus GN=Csa_4G280640 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 1.7e-15 Identity = 52/99 (52.53%), Postives = 60/99 (60.61%), Query Frame = 1
BLAST of CSPI04G13120 vs. TrEMBL
Match: A0A161ZM20_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_024344 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.1e-13 Identity = 47/99 (47.47%), Postives = 61/99 (61.62%), Query Frame = 1
BLAST of CSPI04G13120 vs. TrEMBL
Match: A0A0A0KZ50_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G280610 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.7e-13 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CSPI04G13120 vs. TAIR10
Match: AT1G58170.1 (AT1G58170.1 Disease resistance-responsive (dirigent-like protein) family protein) HSP 1 Score: 72.4 bits (176), Expect = 1.9e-13 Identity = 43/99 (43.43%), Postives = 57/99 (57.58%), Query Frame = 1
BLAST of CSPI04G13120 vs. TAIR10
Match: AT1G22900.1 (AT1G22900.1 Disease resistance-responsive (dirigent-like protein) family protein) HSP 1 Score: 66.2 bits (160), Expect = 1.4e-11 Identity = 45/103 (43.69%), Postives = 56/103 (54.37%), Query Frame = 1
BLAST of CSPI04G13120 vs. TAIR10
Match: AT2G21100.1 (AT2G21100.1 Disease resistance-responsive (dirigent-like protein) family protein) HSP 1 Score: 61.2 bits (147), Expect = 4.3e-10 Identity = 38/94 (40.43%), Postives = 50/94 (53.19%), Query Frame = 1
BLAST of CSPI04G13120 vs. TAIR10
Match: AT5G42500.1 (AT5G42500.1 Disease resistance-responsive (dirigent-like protein) family protein) HSP 1 Score: 60.5 bits (145), Expect = 7.4e-10 Identity = 41/100 (41.00%), Postives = 53/100 (53.00%), Query Frame = 1
BLAST of CSPI04G13120 vs. TAIR10
Match: AT5G42510.1 (AT5G42510.1 Disease resistance-responsive (dirigent-like protein) family protein) HSP 1 Score: 58.9 bits (141), Expect = 2.2e-09 Identity = 40/101 (39.60%), Postives = 54/101 (53.47%), Query Frame = 1
BLAST of CSPI04G13120 vs. NCBI nr
Match: gi|700198927|gb|KGN54085.1| (hypothetical protein Csa_4G280620 [Cucumis sativus]) HSP 1 Score: 100.9 bits (250), Expect = 1.4e-18 Identity = 53/88 (60.23%), Postives = 64/88 (72.73%), Query Frame = 1
BLAST of CSPI04G13120 vs. NCBI nr
Match: gi|659097743|ref|XP_008449790.1| (PREDICTED: dirigent protein 7-like [Cucumis melo]) HSP 1 Score: 97.4 bits (241), Expect = 1.6e-17 Identity = 55/99 (55.56%), Postives = 65/99 (65.66%), Query Frame = 1
BLAST of CSPI04G13120 vs. NCBI nr
Match: gi|778693009|ref|XP_004142157.2| (PREDICTED: dirigent protein 7-like [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 4.5e-17 Identity = 54/99 (54.55%), Postives = 65/99 (65.66%), Query Frame = 1
BLAST of CSPI04G13120 vs. NCBI nr
Match: gi|659097741|ref|XP_008449789.1| (PREDICTED: dirigent protein 20-like [Cucumis melo]) HSP 1 Score: 92.0 bits (227), Expect = 6.5e-16 Identity = 53/99 (53.54%), Postives = 61/99 (61.62%), Query Frame = 1
BLAST of CSPI04G13120 vs. NCBI nr
Match: gi|449448806|ref|XP_004142156.1| (PREDICTED: dirigent protein 19-like [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 2.5e-15 Identity = 52/99 (52.53%), Postives = 60/99 (60.61%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|