WMU78668 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTCCATTGAAGATGACAGAAGTGAAGCTCCATGGAGCTTGGCCAAGTCCATTCAGTTACAGAGTCATTTGGGCTCTGGCTCTCAAAGGCATTCCATACCAATACATAGAAGAGGATCTCGCCAACAAATCTCCTCTGCTTTTGCAATACAATCCCGTTCACAAGAAGATTCCAGTCCTCGTCCATGCCGGAAAACCCATCTGCGAATCCTCCATCATCCTCCAGT
BLAST of WMU78668 vs. TAIR10
Match: AT2G29450.1 (AT2G29450.1 glutathione S-transferase tau 5) HSP 1 Score: 98.6 bits (244), Expect = 1.7e-21 Identity = 48/69 (69.57%), Postives = 52/69 (75.36%), Query Frame = 3
BLAST of WMU78668 vs. TAIR10
Match: AT2G29440.1 (AT2G29440.1 glutathione S-transferase tau 6) HSP 1 Score: 97.1 bits (240), Expect = 5.0e-21 Identity = 47/72 (65.28%), Postives = 53/72 (73.61%), Query Frame = 3
BLAST of WMU78668 vs. TAIR10
Match: AT2G29420.1 (AT2G29420.1 glutathione S-transferase tau 7) HSP 1 Score: 94.7 bits (234), Expect = 2.5e-20 Identity = 45/69 (65.22%), Postives = 52/69 (75.36%), Query Frame = 3
BLAST of WMU78668 vs. TAIR10
Match: AT2G29490.1 (AT2G29490.1 glutathione S-transferase TAU 1) HSP 1 Score: 94.4 bits (233), Expect = 3.2e-20 Identity = 45/72 (62.50%), Postives = 53/72 (73.61%), Query Frame = 3
BLAST of WMU78668 vs. TAIR10
Match: AT5G62480.1 (AT5G62480.1 glutathione S-transferase tau 9) HSP 1 Score: 93.2 bits (230), Expect = 7.2e-20 Identity = 44/69 (63.77%), Postives = 53/69 (76.81%), Query Frame = 3
BLAST of WMU78668 vs. Swiss-Prot
Match: GSTX3_TOBAC (Probable glutathione S-transferase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 7.2e-22 Identity = 49/71 (69.01%), Postives = 55/71 (77.46%), Query Frame = 3
BLAST of WMU78668 vs. Swiss-Prot
Match: GSTX1_SOLTU (Probable glutathione S-transferase OS=Solanum tuberosum GN=PRP1 PE=2 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 9.5e-22 Identity = 49/71 (69.01%), Postives = 56/71 (78.87%), Query Frame = 3
BLAST of WMU78668 vs. Swiss-Prot
Match: GSTX2_TOBAC (Probable glutathione S-transferase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 2.1e-21 Identity = 49/71 (69.01%), Postives = 55/71 (77.46%), Query Frame = 3
BLAST of WMU78668 vs. Swiss-Prot
Match: GSTX1_TOBAC (Probable glutathione S-transferase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.3e-20 Identity = 47/71 (66.20%), Postives = 53/71 (74.65%), Query Frame = 3
BLAST of WMU78668 vs. Swiss-Prot
Match: GSTU5_ARATH (Glutathione S-transferase U5 OS=Arabidopsis thaliana GN=GSTU5 PE=2 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 3.0e-20 Identity = 48/69 (69.57%), Postives = 52/69 (75.36%), Query Frame = 3
BLAST of WMU78668 vs. NCBI nr
Match: gi|659075966|ref|XP_008438427.1| (PREDICTED: probable glutathione S-transferase isoform X2 [Cucumis melo]) HSP 1 Score: 146.0 bits (367), Expect = 2.7e-32 Identity = 67/71 (94.37%), Postives = 69/71 (97.18%), Query Frame = 3
BLAST of WMU78668 vs. NCBI nr
Match: gi|778678021|ref|XP_011650902.1| (PREDICTED: probable glutathione S-transferase [Cucumis sativus]) HSP 1 Score: 140.6 bits (353), Expect = 1.1e-30 Identity = 64/71 (90.14%), Postives = 68/71 (95.77%), Query Frame = 3
BLAST of WMU78668 vs. NCBI nr
Match: gi|659075964|ref|XP_008438426.1| (PREDICTED: probable glutathione S-transferase isoform X1 [Cucumis melo]) HSP 1 Score: 139.4 bits (350), Expect = 2.5e-30 Identity = 65/71 (91.55%), Postives = 67/71 (94.37%), Query Frame = 3
BLAST of WMU78668 vs. NCBI nr
Match: gi|659075968|ref|XP_008438428.1| (PREDICTED: probable glutathione S-transferase isoform X3 [Cucumis melo]) HSP 1 Score: 139.4 bits (350), Expect = 2.5e-30 Identity = 65/71 (91.55%), Postives = 67/71 (94.37%), Query Frame = 3
BLAST of WMU78668 vs. NCBI nr
Match: gi|449433207|ref|XP_004134389.1| (PREDICTED: probable glutathione S-transferase [Cucumis sativus]) HSP 1 Score: 139.0 bits (349), Expect = 3.2e-30 Identity = 64/71 (90.14%), Postives = 67/71 (94.37%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|