WMU78351 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CGTATTCTTCCACTGCACGCTCTAATTAAAATTTTGGAGCTTTGACTTCATTTAATGGGGTATCCTCTCCTATATCATCACGCTGGCCATGAAGTTTACCTTCGTTTTAATTAAAAGTGCAACATCTTCTCAATCTCATCCTTTGCTCTTTCAAAACACTTTAGCTGCTTTGACTGTACTATCTGATTGAGACTCTGTTTTCTCCCCTTTGGACTCTGCTGCAACAGTTTCATCCTTTGGGTGGATCGTTTGAACAAGCGCCTCGATCTCCTCTTTCATTCTCTCAAACACGTTTGGCGCCCTGACTTCATCCAACGGGGTGTTCTCGTCAATGTCATTACGCCTTCCATGAGTTTCCTTAACATTGGACGGGGCATCTATCAATCTGTAAC
BLAST of WMU78351 vs. TAIR10
Match: AT5G57000.1 (AT5G57000.1 unknown protein) HSP 1 Score: 70.9 bits (172), Expect = 6.7e-13 Identity = 36/61 (59.02%), Postives = 42/61 (68.85%), Query Frame = -3
HSP 2 Score: 40.0 bits (92), Expect = 1.3e-03 Identity = 22/54 (40.74%), Postives = 33/54 (61.11%), Query Frame = -3
BLAST of WMU78351 vs. TAIR10
Match: AT1G72690.1 (AT1G72690.1 unknown protein) HSP 1 Score: 57.4 bits (137), Expect = 7.7e-09 Identity = 24/42 (57.14%), Postives = 30/42 (71.43%), Query Frame = -3
HSP 2 Score: 32.3 bits (72), Expect = 2.7e-01 Identity = 17/49 (34.69%), Postives = 23/49 (46.94%), Query Frame = -3
BLAST of WMU78351 vs. TAIR10
Match: AT1G17490.1 (AT1G17490.1 unknown protein) HSP 1 Score: 52.4 bits (124), Expect = 2.5e-07 Identity = 23/41 (56.10%), Postives = 27/41 (65.85%), Query Frame = -3
BLAST of WMU78351 vs. NCBI nr
Match: gi|659074979|ref|XP_008437898.1| (PREDICTED: uncharacterized protein LOC103483189 [Cucumis melo]) HSP 1 Score: 116.7 bits (291), Expect = 3.0e-23 Identity = 60/78 (76.92%), Postives = 70/78 (89.74%), Query Frame = -3
BLAST of WMU78351 vs. NCBI nr
Match: gi|449432046|ref|XP_004133811.1| (PREDICTED: uncharacterized protein LOC101209332 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 3.4e-22 Identity = 60/78 (76.92%), Postives = 68/78 (87.18%), Query Frame = -3
BLAST of WMU78351 vs. NCBI nr
Match: gi|848898100|ref|XP_012849155.1| (PREDICTED: uncharacterized protein LOC105968986 [Erythranthe guttata]) HSP 1 Score: 81.3 bits (199), Expect = 1.4e-12 Identity = 45/73 (61.64%), Postives = 53/73 (72.60%), Query Frame = -3
BLAST of WMU78351 vs. NCBI nr
Match: gi|297738646|emb|CBI27891.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 80.9 bits (198), Expect = 1.8e-12 Identity = 42/74 (56.76%), Postives = 55/74 (74.32%), Query Frame = -3
BLAST of WMU78351 vs. NCBI nr
Match: gi|225444877|ref|XP_002281464.1| (PREDICTED: uncharacterized protein LOC100256150 [Vitis vinifera]) HSP 1 Score: 80.9 bits (198), Expect = 1.8e-12 Identity = 42/74 (56.76%), Postives = 55/74 (74.32%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|