WMU75754 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAGTCTTGAAAACTCCTCCTGGATTAACCATTAGGATTAAGAAGAACATTAGAATATGTGGTGACTGCCATTCTGCATTCAAGTTTGCTTCAAAAGTCTTGGAAAGAGAAATCATCGTAAGAGACACCAATAGACTTCACCATTTCCTTCATGGCTTGTGTTCTTGTAGGGACTATTGGTAGCCTATTACTTCTTCATTACTAAGATTTCGCCAGTAGATTTGAGATGTTCAGATATAGCTTTCAATGGCTTGAGTTCAAACTTACCAAGAAGAAGCCCAATACTTAAATGTTGGTTGAAGGAAGGTTCTCTTATCTAACTTCAATCTTTTGAACTCACATGTTTATGATTTTTCTAATGGTAGATGCTACAAGAATACAATAGAATAAAGTTCAAATAAGCAAACATATCAACAATTGATTGGTGATGATAAATTAAGAACCAAGCATTTATACTACATGGGGATTGTATAGCTGGTTCATTTTG
BLAST of WMU75754 vs. TAIR10
Match: AT1G56690.1 (AT1G56690.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 94.0 bits (232), Expect = 9.2e-20 Identity = 39/59 (66.10%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of WMU75754 vs. TAIR10
Match: AT4G33990.1 (AT4G33990.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-19 Identity = 39/59 (66.10%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of WMU75754 vs. TAIR10
Match: AT3G23330.1 (AT3G23330.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 90.9 bits (224), Expect = 7.8e-19 Identity = 39/59 (66.10%), Postives = 42/59 (71.19%), Query Frame = 3
BLAST of WMU75754 vs. TAIR10
Match: AT2G22070.1 (AT2G22070.1 pentatricopeptide (PPR) repeat-containing protein) HSP 1 Score: 90.1 bits (222), Expect = 1.3e-18 Identity = 37/59 (62.71%), Postives = 43/59 (72.88%), Query Frame = 3
BLAST of WMU75754 vs. TAIR10
Match: AT5G06540.1 (AT5G06540.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 89.4 bits (220), Expect = 2.3e-18 Identity = 37/59 (62.71%), Postives = 44/59 (74.58%), Query Frame = 3
BLAST of WMU75754 vs. Swiss-Prot
Match: PP252_ARATH (Pentatricopeptide repeat-containing protein At3g24000, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H87 PE=3 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 7.8e-21 Identity = 44/59 (74.58%), Postives = 47/59 (79.66%), Query Frame = 3
BLAST of WMU75754 vs. Swiss-Prot
Match: PPR84_ARATH (Pentatricopeptide repeat-containing protein At1g56690, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H69 PE=2 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.6e-18 Identity = 39/59 (66.10%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of WMU75754 vs. Swiss-Prot
Match: PP348_ARATH (Pentatricopeptide repeat-containing protein At4g33990 OS=Arabidopsis thaliana GN=EMB2758 PE=3 SV=2) HSP 1 Score: 92.8 bits (229), Expect = 3.6e-18 Identity = 39/59 (66.10%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of WMU75754 vs. Swiss-Prot
Match: PP251_ARATH (Putative pentatricopeptide repeat-containing protein At3g23330 OS=Arabidopsis thaliana GN=PCMP-H32 PE=3 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 1.4e-17 Identity = 39/59 (66.10%), Postives = 42/59 (71.19%), Query Frame = 3
BLAST of WMU75754 vs. Swiss-Prot
Match: PP168_ARATH (Pentatricopeptide repeat-containing protein At2g22070 OS=Arabidopsis thaliana GN=PCMP-H41 PE=3 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 2.4e-17 Identity = 37/59 (62.71%), Postives = 43/59 (72.88%), Query Frame = 3
BLAST of WMU75754 vs. NCBI nr
Match: gi|659128608|ref|XP_008464284.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial isoform X1 [Cucumis melo]) HSP 1 Score: 129.0 bits (323), Expect = 7.3e-27 Identity = 56/59 (94.92%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of WMU75754 vs. NCBI nr
Match: gi|659128610|ref|XP_008464285.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial isoform X2 [Cucumis melo]) HSP 1 Score: 129.0 bits (323), Expect = 7.3e-27 Identity = 56/59 (94.92%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of WMU75754 vs. NCBI nr
Match: gi|449443492|ref|XP_004139511.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial-like [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 1.6e-26 Identity = 55/59 (93.22%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of WMU75754 vs. NCBI nr
Match: gi|224089505|ref|XP_002308737.1| (pentatricopeptide repeat-containing family protein [Populus trichocarpa]) HSP 1 Score: 114.0 bits (284), Expect = 2.4e-22 Identity = 48/59 (81.36%), Postives = 51/59 (86.44%), Query Frame = 3
BLAST of WMU75754 vs. NCBI nr
Match: gi|743923367|ref|XP_011005774.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial-like [Populus euphratica]) HSP 1 Score: 114.0 bits (284), Expect = 2.4e-22 Identity = 48/59 (81.36%), Postives = 51/59 (86.44%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|