WMU75514 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGCCTCTCGCTGAGCGTCCGGAACAATGTCAAAGGATCGTTGTCACAGAGGGCTCGGGAGAGATCAATTCGTTATGGATCCGTAATTTGTATGGCCAAAAGATATGCTCCTGAAACTACAAAGAGGAAGAGGTTAAGTAGGAAGAGGGGTGGTGATCCAGACAAGAAAAAAAAGACAAGGAGAAAGGGAAGGGAAAGAA
BLAST of WMU75514 vs. NCBI nr
Match: gi|659112008|ref|XP_008456021.1| (PREDICTED: uncharacterized protein LOC103496073 [Cucumis melo]) HSP 1 Score: 71.2 bits (173), Expect = 7.4e-10 Identity = 37/45 (82.22%), Postives = 39/45 (86.67%), Query Frame = 1
BLAST of WMU75514 vs. NCBI nr
Match: gi|778680352|ref|XP_011651295.1| (PREDICTED: uncharacterized protein LOC105434866 isoform X2 [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 2.8e-09 Identity = 36/45 (80.00%), Postives = 39/45 (86.67%), Query Frame = 1
BLAST of WMU75514 vs. NCBI nr
Match: gi|778680349|ref|XP_011651294.1| (PREDICTED: uncharacterized protein LOC105434866 isoform X1 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 5.9e-07 Identity = 31/33 (93.94%), Postives = 31/33 (93.94%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|