|
|
| Name | WMU75231 |
|---|
| Type | transcribed_cluster |
|---|
| Organism | Citrullus. lanatus (Watermelon (97103) v1) |
|---|
| Description | Late embryogenesis abundant hydroxyproline-rich glycoprotein family |
|---|
| Location | Chr5 : 37963 .. 38140 (+) |
|---|
| Sequence length | 189 |
|---|
The following sequences are available for this feature:
transcribed_cluster sequence TAGACTAAGATGGAAAGCTGGGTCACTAAAGACTGCACGCTATGCGGTATATGTGAAATGTGATGTGTTGGTGGGGTGTGAAAAGAGGCTTGGTGGGTCAACTTCCCATGCTTGCTTCTCCCGCTTGCAAAGTTGATATGTAGTTTTTCATAATTAATTATACAAATAAATGTTTACTCTACAAAAAAA
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
This transcribed_cluster is associated with the following gene feature(s):
| Feature Name | Unique Name | Type |
|---|
| Cla021058 | Cla021058 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| S4_0027395 | S4_0027395 | EST |
|
