WMU74783 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGGAAATCGCCGATCTCTGTGAAGGGATTTACGGTACTGGAGGAGGTGGGTCCTACACAGGGCAGTTGATGGACGGCCGTGATGGGGCCACGTACAACATGAATGGGATCAGACGTAGGTATTTGGTCCAGTGGGTTTGGAATCATGTGGTAAATTACTGTACTGGCCCTAATGCATTGGATCAGTAGTAGAGCCAGAGGTATATATCTCTTG
BLAST of WMU74783 vs. TAIR10
Match: AT5G51550.1 (AT5G51550.1 EXORDIUM like 3) HSP 1 Score: 84.3 bits (207), Expect = 3.2e-17 Identity = 36/60 (60.00%), Postives = 42/60 (70.00%), Query Frame = 3
BLAST of WMU74783 vs. TAIR10
Match: AT2G17230.1 (AT2G17230.1 EXORDIUM like 5) HSP 1 Score: 58.2 bits (139), Expect = 2.4e-09 Identity = 27/61 (44.26%), Postives = 35/61 (57.38%), Query Frame = 3
BLAST of WMU74783 vs. Swiss-Prot
Match: EXOL3_ARATH (Protein EXORDIUM-like 3 OS=Arabidopsis thaliana GN=EXL3 PE=2 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 5.6e-16 Identity = 36/60 (60.00%), Postives = 42/60 (70.00%), Query Frame = 3
BLAST of WMU74783 vs. Swiss-Prot
Match: EXOL5_ARATH (Protein EXORDIUM-like 5 OS=Arabidopsis thaliana GN=EXL5 PE=2 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.3e-08 Identity = 27/61 (44.26%), Postives = 35/61 (57.38%), Query Frame = 3
BLAST of WMU74783 vs. NCBI nr
Match: gi|449460796|ref|XP_004148130.1| (PREDICTED: protein EXORDIUM-like 3 [Cucumis sativus]) HSP 1 Score: 107.1 bits (266), Expect = 1.3e-20 Identity = 48/61 (78.69%), Postives = 48/61 (78.69%), Query Frame = 3
BLAST of WMU74783 vs. NCBI nr
Match: gi|659077253|ref|XP_008439107.1| (PREDICTED: uncharacterized protein LOC103483997 [Cucumis melo]) HSP 1 Score: 107.1 bits (266), Expect = 1.3e-20 Identity = 48/61 (78.69%), Postives = 48/61 (78.69%), Query Frame = 3
BLAST of WMU74783 vs. NCBI nr
Match: gi|641846530|gb|KDO65413.1| (hypothetical protein CISIN_1g041686mg [Citrus sinensis]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 45/61 (73.77%), Postives = 47/61 (77.05%), Query Frame = 3
BLAST of WMU74783 vs. NCBI nr
Match: gi|568873927|ref|XP_006490077.1| (PREDICTED: protein EXORDIUM-like 3 [Citrus sinensis]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 45/61 (73.77%), Postives = 47/61 (77.05%), Query Frame = 3
BLAST of WMU74783 vs. NCBI nr
Match: gi|567858092|ref|XP_006421729.1| (hypothetical protein CICLE_v10005370mg [Citrus clementina]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 45/61 (73.77%), Postives = 47/61 (77.05%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|